ID: 1088631456

View in Genome Browser
Species Human (GRCh38)
Location 11:111777747-111777769
Sequence TGCCAGTGAAATATTTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088631456_1088631463 14 Left 1088631456 11:111777747-111777769 CCTCCACAAATATTTCACTGGCA No data
Right 1088631463 11:111777784-111777806 GCACATTATAGGAAATACCAGGG No data
1088631456_1088631464 17 Left 1088631456 11:111777747-111777769 CCTCCACAAATATTTCACTGGCA No data
Right 1088631464 11:111777787-111777809 CATTATAGGAAATACCAGGGAGG No data
1088631456_1088631462 13 Left 1088631456 11:111777747-111777769 CCTCCACAAATATTTCACTGGCA No data
Right 1088631462 11:111777783-111777805 AGCACATTATAGGAAATACCAGG No data
1088631456_1088631460 -10 Left 1088631456 11:111777747-111777769 CCTCCACAAATATTTCACTGGCA No data
Right 1088631460 11:111777760-111777782 TTCACTGGCAAGGAAAAAATGGG No data
1088631456_1088631461 3 Left 1088631456 11:111777747-111777769 CCTCCACAAATATTTCACTGGCA No data
Right 1088631461 11:111777773-111777795 AAAAAATGGGAGCACATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088631456 Original CRISPR TGCCAGTGAAATATTTGTGG AGG (reversed) Intergenic
No off target data available for this crispr