ID: 1088631457

View in Genome Browser
Species Human (GRCh38)
Location 11:111777750-111777772
Sequence CCTTGCCAGTGAAATATTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088631457_1088631463 11 Left 1088631457 11:111777750-111777772 CCACAAATATTTCACTGGCAAGG No data
Right 1088631463 11:111777784-111777806 GCACATTATAGGAAATACCAGGG No data
1088631457_1088631462 10 Left 1088631457 11:111777750-111777772 CCACAAATATTTCACTGGCAAGG No data
Right 1088631462 11:111777783-111777805 AGCACATTATAGGAAATACCAGG No data
1088631457_1088631464 14 Left 1088631457 11:111777750-111777772 CCACAAATATTTCACTGGCAAGG No data
Right 1088631464 11:111777787-111777809 CATTATAGGAAATACCAGGGAGG No data
1088631457_1088631461 0 Left 1088631457 11:111777750-111777772 CCACAAATATTTCACTGGCAAGG No data
Right 1088631461 11:111777773-111777795 AAAAAATGGGAGCACATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088631457 Original CRISPR CCTTGCCAGTGAAATATTTG TGG (reversed) Intergenic
No off target data available for this crispr