ID: 1088631462

View in Genome Browser
Species Human (GRCh38)
Location 11:111777783-111777805
Sequence AGCACATTATAGGAAATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088631456_1088631462 13 Left 1088631456 11:111777747-111777769 CCTCCACAAATATTTCACTGGCA No data
Right 1088631462 11:111777783-111777805 AGCACATTATAGGAAATACCAGG No data
1088631457_1088631462 10 Left 1088631457 11:111777750-111777772 CCACAAATATTTCACTGGCAAGG No data
Right 1088631462 11:111777783-111777805 AGCACATTATAGGAAATACCAGG No data
1088631454_1088631462 29 Left 1088631454 11:111777731-111777753 CCTTCTTTTCTACATACCTCCAC No data
Right 1088631462 11:111777783-111777805 AGCACATTATAGGAAATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088631462 Original CRISPR AGCACATTATAGGAAATACC AGG Intergenic
No off target data available for this crispr