ID: 1088633050

View in Genome Browser
Species Human (GRCh38)
Location 11:111792621-111792643
Sequence GATTATGCACTGAGGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088633050_1088633053 21 Left 1088633050 11:111792621-111792643 CCAAGCTCCCTCAGTGCATAATC 0: 1
1: 0
2: 3
3: 25
4: 178
Right 1088633053 11:111792665-111792687 AAATTCTAAATAATGTATTCAGG 0: 1
1: 0
2: 8
3: 66
4: 587
1088633050_1088633054 29 Left 1088633050 11:111792621-111792643 CCAAGCTCCCTCAGTGCATAATC 0: 1
1: 0
2: 3
3: 25
4: 178
Right 1088633054 11:111792673-111792695 AATAATGTATTCAGGAAATAAGG 0: 1
1: 0
2: 2
3: 46
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088633050 Original CRISPR GATTATGCACTGAGGGAGCT TGG (reversed) Intronic
900202733 1:1418477-1418499 AATTGTGCACTTGGGGAGCTCGG - Exonic
902765040 1:18608266-18608288 GATTTTGAACTGAGGTAACTTGG - Intergenic
903343283 1:22668300-22668322 GATTAGGAACTAGGGGAGCTTGG + Intergenic
903849237 1:26296377-26296399 GATGAGGCACTGAGAAAGCTCGG + Intronic
905617726 1:39413193-39413215 GAGCATGCACTGTGGTAGCTGGG - Exonic
907587757 1:55636504-55636526 GCTTATCCACTGAGGTAGCCTGG + Intergenic
911912708 1:103655175-103655197 AATTGTGCACTTGGGGAGCTCGG - Intergenic
911915747 1:103696773-103696795 AATTGTGCACTTGGGGAGCTCGG + Intronic
911920120 1:103749313-103749335 AATTGTGCACTTGGGGAGCTCGG - Intronic
913205952 1:116538953-116538975 GGATATGCACTCAGGCAGCTGGG - Intronic
915587559 1:156852391-156852413 GACTAGGCACTGTGGGAGGTGGG - Intronic
917115658 1:171600802-171600824 AATTGTGCACTCAGGGAGCTCGG + Intergenic
918646691 1:186914473-186914495 AATTACTCACTCAGGGAGCTCGG - Intronic
919817403 1:201450157-201450179 GATTGTGTAGTGTGGGAGCTGGG - Intergenic
920937324 1:210447744-210447766 AATTATGCACTCAGAGAGCTTGG - Intronic
923030854 1:230248096-230248118 TATCCTGCAGTGAGGGAGCTGGG + Intronic
924334361 1:242972402-242972424 GATTATGCAGTGAGGGGCTTAGG - Intergenic
1065801970 10:29360534-29360556 AATTGTGCACTCGGGGAGCTCGG - Intergenic
1067098418 10:43317424-43317446 GATTCTGCACGTAAGGAGCTTGG + Intergenic
1070576562 10:77683367-77683389 AATTGTGCATTCAGGGAGCTCGG + Intergenic
1070796714 10:79221168-79221190 GATCATGCAGTGAGTGAGCTTGG + Intronic
1071100978 10:82037318-82037340 CATTCTGCCCTGATGGAGCTGGG - Intronic
1072673742 10:97450512-97450534 GATTTTGCCCTGAGGCAGCCAGG - Exonic
1072689353 10:97561425-97561447 AATTGTGCATTCAGGGAGCTCGG - Intronic
1072770449 10:98133422-98133444 AATTGTGCACTCGGGGAGCTTGG + Intergenic
1082779739 11:57277822-57277844 GATCATGCCCTGAGGGAGGAAGG - Intergenic
1083383290 11:62286574-62286596 AATTATGCACTCAGGGAGCTTGG - Intergenic
1084942915 11:72623455-72623477 GATAATGGAGAGAGGGAGCTTGG - Intronic
1085229636 11:74954328-74954350 GATTAAGCACTGGGGGAGCCAGG - Intronic
1085240417 11:75049490-75049512 AATTGTGCACTCGGGGAGCTCGG - Intergenic
1085692581 11:78675897-78675919 TATTATTCCCTGAGTGAGCTTGG - Intronic
1086745577 11:90422808-90422830 AATTGTGCACTCGGGGAGCTCGG - Intergenic
1086937375 11:92759593-92759615 CCTTATGGCCTGAGGGAGCTGGG + Intronic
1088069671 11:105766731-105766753 GATTTTACACTGAATGAGCTAGG - Intronic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1088860081 11:113790920-113790942 CTTTATGCACTGAGGGATCATGG - Intergenic
1089706045 11:120278574-120278596 GTTTATCCAGTGAGGGAGATGGG + Intronic
1098782499 12:74704557-74704579 GACTTTGAACTGAGGGAGATTGG - Intergenic
1101923474 12:108952112-108952134 GATTCTGCAGTGAGGCAGTTTGG - Intronic
1104882915 12:132084616-132084638 GAGTGTTCACTGAGGGAGGTGGG - Intronic
1105695100 13:22880640-22880662 AATTGTGCACTCGGGGAGCTCGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107700765 13:43045409-43045431 AATTGTGCACTCGGGGAGCTTGG - Intronic
1108254742 13:48599102-48599124 TACTTTGCACTGAGGGAGATTGG + Intergenic
1111111530 13:83716132-83716154 AATTACTCACTCAGGGAGCTCGG + Intergenic
1114378526 14:22175390-22175412 AATTGTGCACTTGGGGAGCTTGG + Intergenic
1115779066 14:36749542-36749564 GGTTTTGCTCTGAGGGAGATAGG - Intronic
1116057030 14:39876562-39876584 TATTGTGCACTCGGGGAGCTCGG - Intergenic
1117285808 14:54284845-54284867 GATTGTGAAGTGAGTGAGCTCGG - Intergenic
1117566049 14:56994685-56994707 AATATTGCACTGGGGGAGCTGGG + Intergenic
1118494163 14:66291677-66291699 GTGTATGCACTTAGGGAGCATGG - Intergenic
1118783346 14:69025131-69025153 GGTTTTGCTCTGAGTGAGCTGGG - Intergenic
1120020933 14:79529135-79529157 AATTGTGCACTCAGAGAGCTCGG - Intronic
1121349956 14:93165472-93165494 AATTGTGCACTTGGGGAGCTCGG + Intergenic
1121535153 14:94686106-94686128 GATGATGCACTGAGAGACCCAGG + Intergenic
1122482545 14:102056364-102056386 AATTGTGCACTTGGGGAGCTGGG + Intergenic
1122651281 14:103228517-103228539 GAGTCTGCACTAAGGGTGCTGGG + Intergenic
1124365591 15:29069030-29069052 GATTTTTCACTGTGGGGGCTGGG - Intronic
1124807310 15:32898568-32898590 CATAAAGCACTGAGGCAGCTAGG + Intronic
1126419795 15:48459389-48459411 GATTTGGCACTAAGGGAGCCAGG + Intronic
1129275643 15:74443512-74443534 GTATATGTACTGAGGGGGCTGGG - Intergenic
1133718872 16:8475392-8475414 TATTATGCACACAGGGAGTTGGG - Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136072416 16:27795840-27795862 GATTCTTCACTGAGGGAGGCGGG - Intronic
1136598510 16:31268130-31268152 GAGAATGCACTCAGGAAGCTTGG - Intronic
1141255905 16:82402098-82402120 CATTTTGCCCTGAGGGAGATGGG + Intergenic
1143375108 17:6462731-6462753 GATGATGATCTGAGGGATCTGGG + Intronic
1144839642 17:18177983-18178005 CATTGTGCACTGTGGGAGCCAGG + Intronic
1148013014 17:44500547-44500569 TATTATGGAGTGAGGGAGTTGGG - Intronic
1151778512 17:76226180-76226202 CTTTATGCACTGAGGGATCATGG + Intronic
1157093434 18:44663119-44663141 GACTATGCACTAAAGGAGCATGG - Intergenic
1158639136 18:59188404-59188426 GAGTAAGCACTGGGGCAGCTAGG + Intergenic
1158980509 18:62756199-62756221 CATTATCCACTCAGGGAGCCAGG + Intronic
1159422961 18:68247161-68247183 CATTATACCCTGAGGGTGCTGGG - Intergenic
1159953223 18:74500766-74500788 AATTGTGCACTCAGGGAGCTCGG - Intronic
1160273570 18:77409659-77409681 GGTGAAGCACTGAGGGAGGTGGG + Intergenic
1161210657 19:3063529-3063551 GATTTTGCTCTGAGTGAGGTAGG + Intergenic
1162857079 19:13476979-13477001 GCTTTTGCTCTGAGGGAGCTGGG - Intronic
1163000139 19:14362103-14362125 GCTTTTGCACTGAGTGAGGTGGG + Intergenic
1163124709 19:15238684-15238706 GATTAGCTCCTGAGGGAGCTGGG - Intronic
1163534427 19:17869042-17869064 GATTTTGTTCTGAGGGTGCTGGG - Intergenic
1164931140 19:32177260-32177282 GAAAAGGCAATGAGGGAGCTGGG + Intergenic
1167418509 19:49389642-49389664 GAGCAGGCACTGGGGGAGCTGGG + Intronic
1167915347 19:52735625-52735647 AATTGTGCACTCGGGGAGCTTGG + Intergenic
1167935041 19:52898624-52898646 AATTGTGCATTCAGGGAGCTCGG - Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
928204645 2:29275288-29275310 GATTTCACACTGAGGGAGGTGGG + Intronic
929826141 2:45310787-45310809 GAGGATGGACTGAGGGGGCTCGG - Intergenic
930785979 2:55271710-55271732 AATTGTGCACTCAGGGAGCTCGG + Intergenic
931980993 2:67694155-67694177 GATTATTTACTGACTGAGCTAGG - Intergenic
936011428 2:108927663-108927685 CACTATGCACTCAGGGTGCTGGG - Intronic
936030192 2:109064510-109064532 GACTTTGCACTGAGAGAACTGGG - Intergenic
936468101 2:112772021-112772043 GTTTAGGCAATGAGGGAGGTGGG + Intergenic
937497189 2:122433093-122433115 AATTATTCACTGAGGCAGGTGGG - Intergenic
943621920 2:190158200-190158222 AATTGTGCACTCGGGGAGCTCGG + Intronic
944294146 2:198043101-198043123 GATCATTCATTGAAGGAGCTGGG + Intronic
945228445 2:207557852-207557874 GATTATTCATTGAGTTAGCTAGG + Intronic
945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG + Intergenic
946894853 2:224313086-224313108 GGTGATGCACTGAGGGAGAAAGG - Intergenic
947131814 2:226934824-226934846 AATTATGCACAGAGGGATGTGGG - Intronic
948836158 2:240626926-240626948 GATTCTGCACTGAGTGATCCAGG - Intronic
1169249286 20:4047818-4047840 GAGAAGGCAGTGAGGGAGCTGGG + Intergenic
1172448243 20:35004134-35004156 GACTATTCAGTGAGGGAGTTGGG + Intronic
1174450542 20:50617423-50617445 GATTGTGCAGAGTGGGAGCTGGG - Intronic
1174945773 20:54983754-54983776 AATTGTGCACTCGGGGAGCTCGG - Intergenic
1177375978 21:20271247-20271269 AATTGTGCACTTGGGGAGCTCGG + Intergenic
1179065938 21:38024958-38024980 CATTATGGACAAAGGGAGCTTGG + Intronic
1179553663 21:42159340-42159362 GAATATTCACTTAAGGAGCTGGG + Intergenic
1181904876 22:26186415-26186437 GATTTTGCAGTGGGGGAGATTGG + Intronic
1182051552 22:27316313-27316335 GGTTTTCCTCTGAGGGAGCTGGG - Intergenic
1182636877 22:31735099-31735121 GAATATACACTGGTGGAGCTGGG + Intronic
1182774409 22:32820185-32820207 GATCATGCCCTGAGGGAGTGAGG - Intronic
1183179567 22:36250597-36250619 AATTGTGCACTCAGGGAGCTCGG + Intergenic
1183713854 22:39522151-39522173 CTTTATGCACTGAGGGATCATGG - Exonic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185163777 22:49245185-49245207 GATTATGAACGAAGGGAGCAAGG - Intergenic
955998116 3:64699004-64699026 GATACTGCAGTGAGGAAGCTTGG - Intergenic
957117275 3:76042912-76042934 AATTGTGCACTCAGGGAGCTCGG + Intronic
957999452 3:87733772-87733794 AATTGTGCACTCAGAGAGCTCGG - Intergenic
958000282 3:87740994-87741016 AATTGTGCACTTGGGGAGCTTGG - Intergenic
958040019 3:88216157-88216179 GATTATGTTCTGAGGAAGCCTGG + Intergenic
958790122 3:98642827-98642849 AATTGTGCATTCAGGGAGCTCGG - Intergenic
959294861 3:104522370-104522392 AATTGTGCACTTGGGGAGCTCGG + Intergenic
962769306 3:138597513-138597535 CATTGTGCACTCAGGGAGCTCGG - Intergenic
964210176 3:154217876-154217898 GACTATGCAATGAGGGCGCCCGG + Exonic
967659689 3:192091513-192091535 AATTGTGCACTCGGGGAGCTTGG - Intergenic
968411034 4:390160-390182 AATTGTGCACTCAGGAAGCTCGG + Intergenic
968447650 4:660434-660456 GATTGTGGGCTGAGGGAGGTTGG - Intronic
969852516 4:9971070-9971092 AATTGTGCACTCAGGGAGCTCGG + Intronic
972274728 4:37546548-37546570 AATTGTGCAGTCAGGGAGCTCGG + Intronic
973348361 4:49081645-49081667 GAGTGTGCCCTGAGGGAGGTAGG + Intergenic
973691076 4:53432689-53432711 AATTTTGCACTGAGGAAGCGGGG + Intronic
979052300 4:115950738-115950760 AATTGTGCACTCGGGGAGCTCGG + Intergenic
979052894 4:115956404-115956426 AATTGTGCACTCGGGGAGCTCGG + Intergenic
979242748 4:118462884-118462906 GATTATGCAGTGAGGGGCTTAGG + Intergenic
980341086 4:131548051-131548073 AATTGTGCACTCAGGGAGCTCGG + Intergenic
980571146 4:134622134-134622156 AATTGTGCACTCGGGGAGCTCGG + Intergenic
987215918 5:15737109-15737131 GATTCTGGAATGAGGGGGCTGGG - Intronic
987855867 5:23420184-23420206 AATTGTGCACTCGGGGAGCTCGG - Intergenic
988120960 5:26961793-26961815 GATAATGCACTCATGGTGCTAGG - Intronic
988444548 5:31270908-31270930 GAGTATGCACTGAGGCAACCTGG - Intronic
989557394 5:42813528-42813550 AATTGTGCACTCGGGGAGCTCGG + Intronic
989775826 5:45206058-45206080 AATTGTGCACTCGGGGAGCTTGG - Intergenic
991396474 5:66209525-66209547 GATTTTGCCCTGAGGGCACTGGG - Intergenic
994663636 5:102683029-102683051 AATTGTGCACTCGGGGAGCTCGG - Intergenic
996581529 5:125037069-125037091 GGTTAGGGACTGAGGGAGGTGGG - Intergenic
998114552 5:139526225-139526247 AATTGTGCACTTAGGGAGCTGGG + Intergenic
1000604435 5:163313139-163313161 AATTGTGCATTCAGGGAGCTCGG - Intergenic
1001414426 5:171534655-171534677 GATTAAGCACTGAGACAGCTGGG - Intergenic
1004246976 6:13987759-13987781 GTCCATGCACTGAGGGAGCAGGG - Intergenic
1004930235 6:20455911-20455933 GGTTAAGCATTGAAGGAGCTAGG + Intronic
1005472769 6:26178181-26178203 AATTGTGCACTCAGAGAGCTCGG + Intergenic
1005562227 6:27052416-27052438 AATTGTGCATTCAGGGAGCTCGG - Intergenic
1008952236 6:57173140-57173162 GATTAAGGACTGTGGCAGCTTGG + Intronic
1009357297 6:62766547-62766569 AATTGTGCATTCAGGGAGCTCGG + Intergenic
1010317577 6:74468501-74468523 AACTGTGCACTCAGGGAGCTTGG + Intergenic
1015110065 6:129582622-129582644 GATTATGTCCTGAGGGCACTTGG - Intronic
1017406884 6:154129111-154129133 AATTGTGTACTCAGGGAGCTTGG - Intronic
1024342448 7:48281222-48281244 GATTATGCAGGGAGGGAGGATGG + Intronic
1025147121 7:56514450-56514472 ATATATGCACTGAGGGAACTGGG - Intergenic
1026319246 7:69254656-69254678 GTATATGCACTGAGGGAACTGGG + Intergenic
1027350245 7:77304753-77304775 AATTGTGCATTCAGGGAGCTCGG - Intronic
1031741426 7:125436470-125436492 AAGTATGCACAGAGGAAGCTGGG + Intergenic
1031742719 7:125454999-125455021 AATTGTGCACTCGGGGAGCTCGG + Intergenic
1032467020 7:132152498-132152520 GATCAAGCACTGGGGGACCTGGG - Intronic
1032782106 7:135171620-135171642 AATTGTGCACTCGGGGAGCTCGG + Intergenic
1037150175 8:15626706-15626728 GATTGGGCACTGTTGGAGCTTGG + Intronic
1037609860 8:20466899-20466921 TCCCATGCACTGAGGGAGCTGGG + Intergenic
1039026706 8:33266765-33266787 CATTAGTCAATGAGGGAGCTGGG - Intergenic
1039876515 8:41591041-41591063 AATTACTCACTCAGGGAGCTTGG - Intronic
1040021044 8:42741613-42741635 AATTGTGCACTCGGGGAGCTTGG - Intergenic
1045494790 8:102699274-102699296 GAGGAAGCACTGAGGGAGCCTGG + Intergenic
1045799591 8:106087128-106087150 GATTGTGCACTCAGGGAGCTCGG - Intergenic
1045834150 8:106500539-106500561 AATTGTGCATTCAGGGAGCTCGG + Intronic
1047387939 8:124426723-124426745 GATTTTGGAGTGAGGGGGCTGGG - Intergenic
1047409010 8:124609092-124609114 GATGATGTTCTCAGGGAGCTGGG - Intronic
1048854810 8:138677323-138677345 GATTATGCAGAGAGAGTGCTTGG + Intronic
1049236866 8:141516634-141516656 GATGAATCACTGAGGGAGTTGGG - Intronic
1057221617 9:93260571-93260593 GATTCAGCACTAACGGAGCTGGG - Intronic
1059874626 9:118620595-118620617 GATTTTGCCCTGCAGGAGCTAGG + Intergenic
1060340875 9:122775973-122775995 AATTGTGCACTCGGGGAGCTCGG + Intergenic
1061875937 9:133544096-133544118 GACAATGCACGCAGGGAGCTGGG + Intronic
1185819695 X:3190442-3190464 GTTTATGTACTGGGGGACCTGGG + Intergenic
1185895978 X:3859263-3859285 AATTGTGCACTCGGGGAGCTCGG + Intergenic
1185901097 X:3897687-3897709 AATTGTGCACTCGGGGAGCTCGG + Intergenic
1185906211 X:3936126-3936148 AATTGTGCACTCGGGGAGCTCGG + Intergenic
1186219422 X:7333815-7333837 GATAATGCACGGACAGAGCTGGG + Intronic
1186339601 X:8630043-8630065 CATTCTGCCCTGAGGGAGCATGG + Intronic
1187399257 X:18945136-18945158 GATTATGGAATGTGGGAGCGTGG - Exonic
1187782625 X:22845192-22845214 GACTATGAAGTTAGGGAGCTAGG + Intergenic
1188897951 X:35693652-35693674 AATTGTGCACTTAGGGGGCTCGG + Intergenic
1191035686 X:56024560-56024582 AATTGTGCACTCAGGGATCTCGG - Intergenic
1191036658 X:56031818-56031840 AATTGTGCACTCGGGGAGCTCGG - Intergenic
1192915010 X:75642721-75642743 AATTGTGCACTCAGGGAGCTCGG - Intergenic
1192915727 X:75649238-75649260 AATTGTGCACTCAGGGAGCTCGG - Intergenic
1193186043 X:78513973-78513995 AATTGTGCACTCAGGGAGCTCGG - Intergenic
1193797771 X:85897660-85897682 GATTAGGCACTGAGGGAAAAGGG + Intronic
1194503512 X:94705708-94705730 AATTGTGCACTCAGGGAGCTCGG + Intergenic
1196252077 X:113473034-113473056 AATTGTGCACTCAGGGAGCTCGG - Intergenic
1197114225 X:122813597-122813619 AATTGTGCACTCAGGGAGCTCGG - Intergenic
1199858417 X:151778857-151778879 GCTTATTCACTCTGGGAGCTTGG + Intergenic
1201696373 Y:16831708-16831730 AATTGTGCACTCAGGGAGCTTGG + Intergenic
1201697339 Y:16840460-16840482 AATTGTGCACTCAGGGAGCTTGG + Intergenic
1202356611 Y:24058208-24058230 GCTTTTTCACTGAGGGAGTTAGG + Intergenic
1202390477 Y:24364985-24365007 GATTATGCAGTGAGGGGCTTAGG + Intergenic
1202480307 Y:25305131-25305153 GATTATGCAGTGAGGGGCTTAGG - Intergenic
1202514167 Y:25611901-25611923 GCTTTTTCACTGAGGGAGTTAGG - Intergenic