ID: 1088637055

View in Genome Browser
Species Human (GRCh38)
Location 11:111832149-111832171
Sequence GCTTGTGGCCTGGTATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088637055 Original CRISPR GCTTGTGGCCTGGTATTGGA AGG (reversed) Intronic
900539697 1:3196642-3196664 GAATGTGGCCTGGAATTGGGTGG - Intronic
901785321 1:11620837-11620859 GCCTGTGGCCTTGTCTTGAATGG - Intergenic
901891740 1:12272107-12272129 GCTTGAGCCCAGGAATTGGAGGG + Intronic
903248487 1:22034557-22034579 GCCTGAGGCCAGGGATTGGAGGG - Intergenic
905155363 1:35974204-35974226 GATTGTGGACAGGTATTAGAGGG - Intronic
912841336 1:113042130-113042152 TCTTCTGGCCTGGAATTGGAAGG + Intergenic
913558651 1:119996223-119996245 GCTTGGGGCCTGGTGTTCCATGG - Intronic
913639192 1:120794248-120794270 GCTTGGGGCCTGGTGTTCCATGG + Intergenic
914279258 1:146155710-146155732 GCTTGGGGCCTGGTGTTCCATGG - Intronic
914540302 1:148606640-148606662 GCTTGGGGCCTGGTGTTCCATGG - Intronic
914626342 1:149464574-149464596 GCTTGGGGCCTGGTGTTCCATGG + Intergenic
916198108 1:162243921-162243943 GCCTGTGGCCTGTCATTTGAGGG + Intronic
919279278 1:195466379-195466401 GCTTGAGCCCAGGAATTGGAGGG - Intergenic
920501602 1:206488675-206488697 GCTTGGGGCCTGGGAGAGGAGGG - Intronic
1065537264 10:26727381-26727403 GCTTGTGGCCTGGAATTAATGGG + Intronic
1067155067 10:43774620-43774642 GCTTGTTTCCTGGTAATAGATGG + Intergenic
1070452526 10:76576308-76576330 CCTTGTGACCTGGGATTGCAAGG - Intergenic
1071133219 10:82420195-82420217 CATTGTGTCCTGGTAATGGAAGG + Intronic
1073010638 10:100356577-100356599 GCTTGTGCCCTGGTATTTCTGGG + Exonic
1073835585 10:107437384-107437406 GAGTGTGTCCTGGTATGGGATGG + Intergenic
1074936821 10:118190186-118190208 CCTTTTGGCCTGGGATGGGAGGG + Intergenic
1082252228 11:49995244-49995266 GCTTGTCCCCTGGTCTTGTAAGG - Intergenic
1082301159 11:50508453-50508475 GCTTATGGCCAGATATTGGGGGG - Intergenic
1082555607 11:54559629-54559651 GCTTGTCCCCTGGTCTTGTAAGG + Intergenic
1082807465 11:57460104-57460126 GCTTGAGGTCTGGGAGTGGAAGG + Intergenic
1084914975 11:72421798-72421820 GCTTGTTCCCTGGTGATGGAAGG - Intronic
1085332711 11:75667341-75667363 GGGTGTGGCCTGGGACTGGAGGG + Intronic
1086964876 11:93017386-93017408 GCTTGAGGCCAGGAGTTGGAAGG - Intergenic
1088637055 11:111832149-111832171 GCTTGTGGCCTGGTATTGGAAGG - Intronic
1088850890 11:113702626-113702648 GCCTCTGGTCTGGTAATGGAAGG - Intronic
1092793703 12:12090681-12090703 GCTTGTGGCTTGGTAAGGGCTGG - Intronic
1093834243 12:23807001-23807023 CCTTGTGGCCAGCTTTTGGATGG + Intronic
1096469590 12:51867985-51868007 GCTTCTGGGCTGGGGTTGGAGGG - Intergenic
1099063292 12:77940345-77940367 GCTTGTGGCCTGATTTTGCTAGG - Exonic
1099310983 12:81022539-81022561 ACTTGGGGCCTTGTATTTGAGGG + Intronic
1101097287 12:101355578-101355600 GCCTGTGGCCTGTTTTTGTACGG + Intronic
1102589030 12:113943363-113943385 GCTTGTGGCACTGTGTTGGATGG - Intronic
1102615707 12:114152270-114152292 GGTTGGGGGCTGATATTGGAAGG + Intergenic
1109314476 13:60734094-60734116 CCTTGGGGCCTATTATTGGAAGG + Intergenic
1114363590 14:22003054-22003076 GCCTGTGGCCTGATCTTGTAGGG + Intergenic
1118000843 14:61522219-61522241 GATGGTGGCCTGGTATAGGGAGG - Intronic
1118772057 14:68948772-68948794 CTTTGTGGCCTGGTAGTGGCTGG - Intronic
1118936125 14:70290038-70290060 CCTTGTGCCCTGTGATTGGAAGG + Intergenic
1119903774 14:78283318-78283340 GCTTGCAGCCTGGTTTTGTATGG + Intronic
1121968639 14:98335558-98335580 GCTGGTGGCCTCATAGTGGATGG + Intergenic
1122505618 14:102229980-102230002 GCCTGTCGCCTGGTTTTGGGTGG + Intronic
1122608882 14:102967595-102967617 GCTTGGGGCCTGGAATTGACAGG - Intronic
1125731104 15:41893232-41893254 GCTGGGGGCCTGGTATGGGTGGG + Intronic
1126670214 15:51109492-51109514 GCTTGTGGTTAGGTCTTGGATGG - Intergenic
1128230722 15:66033291-66033313 GCTCGGGGCCTGTTATGGGAGGG - Intronic
1128497283 15:68205744-68205766 GCTTGGGGCTCGGTATTGCAGGG + Intronic
1129416799 15:75388051-75388073 GCTTTTGCCTTGGTTTTGGAAGG - Intronic
1129427840 15:75477510-75477532 GCTTGAGCCCTGGAAGTGGAAGG + Intronic
1133965281 16:10526624-10526646 CCTTATGGCCTGGTAATGGGTGG - Intergenic
1133965386 16:10527294-10527316 CCTTATGGCCTGGTAATGGGTGG + Intergenic
1134085520 16:11354791-11354813 GCTGGTGGCTTGGTGCTGGAAGG + Intergenic
1136999270 16:35215189-35215211 GAGTGTGGCCTGGAAGTGGAAGG - Intergenic
1137714219 16:50588106-50588128 GCTGGTGGCCTGGTACTGATGGG + Intronic
1141629835 16:85281337-85281359 GCTGGTGGCCGGGGTTTGGAGGG - Intergenic
1141682053 16:85550582-85550604 GGTTGTGGCCTGGTCCTGGGGGG + Intergenic
1143380322 17:6491743-6491765 GCTTGGGGCCTCATATTAGAAGG + Intronic
1143501989 17:7344581-7344603 CCTGGTGGCCTGGTGATGGAAGG + Exonic
1146518999 17:33511703-33511725 GCTTGTGCAATGGGATTGGAGGG - Intronic
1149330226 17:55573632-55573654 GCTTGTGTTCTGCTATTTGAAGG + Intergenic
1149334354 17:55620191-55620213 TCATTTGGCCTGCTATTGGAGGG + Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1151607028 17:75144166-75144188 ACTTGGGGCCTGGTATGGAAAGG - Intronic
1153106907 18:1538060-1538082 GGTTCTGGCCTGGCATTGTAGGG + Intergenic
1155514886 18:26614636-26614658 ACTTGGGGCCTGATCTTGGAAGG + Intronic
1157790646 18:50528209-50528231 GCCTGTGGCCTGGCTTTTGAAGG + Intergenic
1160780084 19:873676-873698 CCTTGTGTCCTGGTACTGGGTGG - Intronic
1161964681 19:7541483-7541505 GCTTGTGGCCTGTCCTGGGAGGG - Intronic
1162459219 19:10804188-10804210 CCTTGTGGGCTGCTATTTGAGGG + Intronic
1162865728 19:13545267-13545289 GATGGTGGCCTGGAATTTGATGG - Intronic
1163646582 19:18493103-18493125 CCTTGTGGTCTGGTCTCGGAGGG - Intronic
1167225092 19:48233086-48233108 GGCTGTGACCTGGTATTGGGTGG - Intronic
925801748 2:7608625-7608647 TGTTGTGGCTTGGTCTTGGATGG - Intergenic
928423922 2:31162355-31162377 GCTTGTCCCCTGGGAATGGAGGG - Intergenic
929175229 2:38969136-38969158 GCCTGTGGACAGGTATAGGAAGG + Intronic
929920503 2:46168085-46168107 TCCTGTGGCCTGGGATTGGGAGG + Intronic
929987991 2:46756458-46756480 GCCTGTGGCCTGTTTTTTGAAGG - Intronic
933663269 2:84944709-84944731 GCATAGGGCATGGTATTGGAGGG - Intergenic
934761121 2:96857756-96857778 GCTTGGGGCCTGGTGCGGGAAGG - Intronic
939262229 2:139825035-139825057 GCTGATGACCTGGTATTGCAAGG + Intergenic
942378528 2:175362061-175362083 ACTTGTGGCCTGGTTTTGGGGGG + Intergenic
942772639 2:179540546-179540568 GCTTATCGCCTGGTCTTAGAAGG + Intronic
945277611 2:208004094-208004116 GCTTCTGGCTTGGTATTTGCAGG + Intronic
947151690 2:227122679-227122701 GGTTGAGCCCTGGTTTTGGAGGG - Intronic
948653409 2:239462901-239462923 GCTTGTGTCCTGCTCTAGGAGGG - Intergenic
1168961547 20:1873483-1873505 CCTGGTGGCCTGGCTTTGGAAGG - Intergenic
1171791795 20:29533291-29533313 GCTTGAGGCCAGGAGTTGGAAGG - Intergenic
1175309249 20:58000002-58000024 GCTTGTGTCCTGGTGAAGGAAGG - Intergenic
1175327082 20:58137398-58137420 GCATCTGGCCTGGTCTGGGAAGG + Intergenic
1175335539 20:58193561-58193583 GCTAGTGGCCTGGTGGTGGGAGG - Intergenic
1177463992 21:21450425-21450447 GCTTGAGCCCAGGTTTTGGAAGG - Intronic
1181119140 22:20653847-20653869 GCTCCTGGACTGCTATTGGATGG + Intergenic
1181627630 22:24132423-24132445 GCATGTGGCCTGGGATAGGGTGG + Intronic
1183232290 22:36590584-36590606 GATGGTGGCCTGGTAGTGGGCGG - Intronic
1183666510 22:39249281-39249303 ATTTGTGGCATGGTCTTGGACGG - Intergenic
1184765991 22:46572892-46572914 CCTTGTGCCCTGGCATGGGAGGG - Intergenic
949857445 3:8474980-8475002 CCTTGTGGCCTTGGATTTGAGGG - Intergenic
950028574 3:9837003-9837025 GCTTGAGGCCAGGAGTTGGAGGG + Intronic
950968795 3:17166107-17166129 GCCTGTGGCCTGTTTTTGCATGG + Intronic
954475282 3:50738366-50738388 GCTTGAGGCCTGGGTTTGTAGGG + Intronic
954788163 3:53110350-53110372 CCCTGTGGCCTGGTACAGGAGGG - Intronic
955352188 3:58201918-58201940 GCTTGTTCCCTGGTACTGCAAGG - Intronic
958466698 3:94468977-94468999 TTTTGTGGACTGATATTGGAAGG + Intergenic
958649053 3:96912969-96912991 GCTAGTGGCATGGTTTTTGAGGG + Intronic
962908336 3:139825379-139825401 GCTGGAGGCCTGGCCTTGGATGG + Intergenic
966060631 3:175749893-175749915 GCTTGTGACCTGCTGTTGGAAGG + Intronic
969365989 4:6694529-6694551 CCTTGTTGCCTGGTATTAGTGGG + Intronic
969396484 4:6924884-6924906 GCTTGTGGCCTGGGGGTGGTGGG + Intronic
970556784 4:17241987-17242009 ACTTGTGGGATGTTATTGGAAGG + Intergenic
971370732 4:26016667-26016689 GGTTGTGGCCTGGCACTGGAGGG - Intergenic
972346376 4:38195970-38195992 GCTTGTGTCTTGGTATTGTAAGG + Intergenic
972877023 4:43374998-43375020 GGTTGGGGTCTGGTGTTGGAGGG + Intergenic
976088036 4:81426088-81426110 GCTTGAGGTCTGGAATTAGAAGG + Intergenic
984903350 4:184604482-184604504 GCTTGTGGCCAGATTTTGGGGGG - Intergenic
992387297 5:76297405-76297427 ACTTGTGGCCTGGGGATGGATGG + Intronic
997910696 5:137870228-137870250 GCTTGTGCCCAGGAGTTGGAGGG + Intronic
998616257 5:143743884-143743906 GCCTGTGTCCTGGTCCTGGATGG - Intergenic
1002669798 5:180857378-180857400 GCTTGTGGACTGTTTTTGTATGG - Intronic
1003588754 6:7418629-7418651 GCTGATGGCTTGGTATAGGATGG + Intergenic
1007949867 6:45861698-45861720 GGTTGTGGCCTAGTAATGGAGGG - Intergenic
1011129258 6:84037452-84037474 GCTTGTGGCATGGGACTGGTGGG - Intronic
1019407122 7:889628-889650 GCATGGGGCCTGGGAGTGGAGGG + Intronic
1019581572 7:1766311-1766333 GCTTGAGGCCAGGAGTTGGAGGG - Intergenic
1020956951 7:14751666-14751688 GATTGTGGCCAGGTTTGGGAGGG + Intronic
1021842454 7:24731968-24731990 GCTGGTCTCCTGGTATTGGCAGG - Intronic
1022392947 7:29959485-29959507 GCTTGAGCCCAGGTATTGGGAGG - Intronic
1027130244 7:75585546-75585568 GCTTGTAGCGTGTGATTGGAGGG - Intronic
1036722333 8:11188197-11188219 GCATGTTACCTGGTTTTGGATGG - Intronic
1037099284 8:15023297-15023319 GTTTGTGGCCAGGTTTGGGAAGG + Intronic
1038403678 8:27305917-27305939 GCTTGAGGCCAGGCATTCGAGGG - Intronic
1043307773 8:78818401-78818423 GCTTGTGGCCTTGTACTGATAGG - Intergenic
1045258011 8:100546245-100546267 CCTTGTGGCCTGTGATGGGAGGG - Intronic
1047401602 8:124553222-124553244 GCTTCGGGCCTGGAAGTGGAGGG + Exonic
1047978764 8:130158430-130158452 GCTTGTGCCCAGGAATTGGGAGG + Intronic
1051753143 9:20365668-20365690 CCTTGTTGCCTGGTCTGGGATGG + Exonic
1051928983 9:22363441-22363463 GCATGTGGCATGGGATTGGCAGG - Intergenic
1052430456 9:28359858-28359880 GCTTATGGACTGATTTTGGAAGG - Intronic
1052694113 9:31854313-31854335 GCTTGTGTGCTGGTGGTGGAGGG - Intergenic
1053484196 9:38439646-38439668 CCTTGTGGTCTGGAATTAGAGGG + Intergenic
1059221172 9:112620484-112620506 GCTTATGACTTGGTGTTGGAAGG - Intronic
1059391705 9:114003254-114003276 GCTTGGGGCCTAGAACTGGAGGG - Intronic
1060417232 9:123439990-123440012 GCTTGTTGCCTTTTATTTGAAGG + Intronic
1061932479 9:133840379-133840401 GCTTGGGGAGTGGGATTGGATGG - Intronic
1186820158 X:13279821-13279843 GCCTGTGGCCTGTCATTGAAGGG + Intergenic
1195596672 X:106699086-106699108 GATTTTGGCCTGGGCTTGGATGG - Intronic
1197316819 X:124976837-124976859 GCTTGTGGCCTGGAATGGCGTGG - Intergenic
1198822183 X:140660248-140660270 GCTTGTGGCTTTGTAAGGGAAGG - Intergenic