ID: 1088637523 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:111837522-111837544 |
| Sequence | ACATTCACAGGTCTGCCTTC TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 193 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 17, 4: 174} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1088637519_1088637523 | -4 | Left | 1088637519 | 11:111837503-111837525 | CCACTCTTTTCCCACACAGACAT | 0: 1 1: 0 2: 2 3: 47 4: 371 |
||
| Right | 1088637523 | 11:111837522-111837544 | ACATTCACAGGTCTGCCTTCTGG | 0: 1 1: 0 2: 1 3: 17 4: 174 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1088637523 | Original CRISPR | ACATTCACAGGTCTGCCTTC TGG | Exonic | ||