ID: 1088637523

View in Genome Browser
Species Human (GRCh38)
Location 11:111837522-111837544
Sequence ACATTCACAGGTCTGCCTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088637519_1088637523 -4 Left 1088637519 11:111837503-111837525 CCACTCTTTTCCCACACAGACAT 0: 1
1: 0
2: 2
3: 47
4: 371
Right 1088637523 11:111837522-111837544 ACATTCACAGGTCTGCCTTCTGG 0: 1
1: 0
2: 1
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088637523 Original CRISPR ACATTCACAGGTCTGCCTTC TGG Exonic