ID: 1088640703

View in Genome Browser
Species Human (GRCh38)
Location 11:111870678-111870700
Sequence CCTTAAAAGCAGGAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088640703 Original CRISPR CCTTAAAAGCAGGAAGTGGA AGG (reversed) Intronic
901646898 1:10721707-10721729 CCTGCAAACCAGGAAGTGGACGG + Intronic
901717017 1:11163773-11163795 CATTTAAAGCAGGGTGTGGAGGG + Intronic
902816936 1:18921900-18921922 CCTTAACTGCAGGAAGGGGTGGG + Intronic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
903490972 1:23728283-23728305 CATTCAAACCAGGAAGTGAAAGG + Intergenic
903773876 1:25780882-25780904 CCCGAAAAGCAGGAGGTGGGAGG + Intronic
904067146 1:27762101-27762123 CATGAAAAGCAGGGAGTGTATGG - Intronic
905237239 1:36558646-36558668 GCTTAAATGCAGGAAGCAGACGG + Intergenic
906903393 1:49862631-49862653 CCCTAAAAGCAGCAAGAGAAAGG + Intronic
907968335 1:59355801-59355823 CTTTAAAAGCAGGCAGTGAGAGG - Intronic
908040309 1:60105619-60105641 CCTTTAAAGCAAGAAGTGGCCGG - Intergenic
908821102 1:68087437-68087459 GCTTAAAAGCAGGAAGCACACGG + Intergenic
909449032 1:75778061-75778083 CCTAAAAAGCTCGAACTGGACGG + Intronic
910111969 1:83692755-83692777 CCTTAAGGGTAGGAGGTGGAAGG - Intergenic
910347193 1:86253599-86253621 TCTTAAAGGAAGGAACTGGAGGG - Intergenic
911222777 1:95266960-95266982 TTTTTCAAGCAGGAAGTGGATGG - Intergenic
911519971 1:98917573-98917595 TCTAAACAGCAGGAAGTGAAAGG - Intronic
911646288 1:100340605-100340627 TCTCATAAGCAGTAAGTGGAGGG + Intergenic
911701048 1:100951952-100951974 TCTTAAAAGATGGAAGTGGAAGG + Intronic
912140059 1:106713768-106713790 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
916865276 1:168849850-168849872 CCAAAAAGGCAGGAAATGGATGG - Intergenic
918440437 1:184561271-184561293 CCTTAAAATTAGGAGGAGGAGGG - Intronic
918452268 1:184670882-184670904 CCTCAAAAGCAGGAAGGGTTGGG - Intergenic
922679256 1:227578065-227578087 CCTTAAAAGCCGGAAGAGACTGG - Intronic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
1063922654 10:10947705-10947727 CCTTGAAAGCAGAAAGTTGAAGG - Intergenic
1064735246 10:18375544-18375566 CCTTAAAACCGGGAAATAGAAGG + Intronic
1064814669 10:19245971-19245993 ACTTAAATGCAGTCAGTGGAAGG + Intronic
1066209171 10:33220034-33220056 CCTTAGAGGCAGGAATTGGGTGG - Intronic
1066653177 10:37678846-37678868 CCTTAGAAGCAGGAATTTAATGG - Intergenic
1067037533 10:42931387-42931409 CCTTAGAAGCAGGAATTTAATGG - Intergenic
1067349005 10:45458867-45458889 CTATAAAAGCAGGAAGTAGCTGG - Intronic
1068420311 10:56782728-56782750 CTTTAAAAGCTGGAAAAGGAAGG - Intergenic
1068484606 10:57641437-57641459 TGTTAAAAACAGGAAATGGAAGG - Intergenic
1068834200 10:61534304-61534326 GGATAAAAGCAGGAAGAGGAAGG - Intergenic
1073322774 10:102625791-102625813 TCTCTAAAGCAAGAAGTGGACGG - Intronic
1073676776 10:105656147-105656169 ACATTAAAGCAGGAAGTTGAAGG + Intergenic
1074332954 10:112538030-112538052 TTTTAAAAACACGAAGTGGATGG + Intronic
1075420728 10:122298545-122298567 CCCAAAAAGCAGGAATTGAAGGG - Intronic
1075581481 10:123621881-123621903 ACATCAAAGGAGGAAGTGGATGG + Intergenic
1075935470 10:126337365-126337387 ACTTCAAAGCAGGAAGAGGAAGG - Intronic
1077753953 11:5005409-5005431 CCTTAAAAGGGGGAAGGGGGAGG - Intergenic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078391952 11:10942699-10942721 CATTAAGAGCAGGAAGAGGTAGG - Intergenic
1079281411 11:19090185-19090207 CATTAAAAGTAGGAGGTAGAAGG + Intergenic
1080245294 11:30173162-30173184 CTCTGAAAGCAGGAAGTGTAGGG - Intergenic
1081483312 11:43508277-43508299 CTTTAAACACAGGAAGGGGAGGG + Intergenic
1083113795 11:60438263-60438285 CATTCAAAGCAGGATGTAGAGGG + Intronic
1085673073 11:78487271-78487293 GCTTAAACCCAGGAGGTGGAGGG + Intronic
1086574964 11:88329397-88329419 TCTTAAACCCAGGAGGTGGAAGG + Intronic
1087859283 11:103133556-103133578 ATTCAAAAGCAGGAAGTGGAGGG + Exonic
1088155454 11:106797757-106797779 CATTCAAAGCAGTATGTGGAGGG + Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1088802863 11:113322467-113322489 TTTTAATAGCAGGAAGTCGATGG + Intronic
1088967225 11:114736019-114736041 CCATAAAACCAGCAAGGGGAGGG + Intergenic
1089270090 11:117296161-117296183 GCATAAAAGCAGGAAGAAGAAGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091086929 11:132730094-132730116 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1092330021 12:7577794-7577816 CTTTAAAAGCAAGAGGCGGAAGG - Intergenic
1092625288 12:10320293-10320315 GCTTGAAAACAGGCAGTGGATGG + Intergenic
1092798405 12:12137864-12137886 CTTTAAAAGCATGAAGAGGCTGG + Intronic
1096367079 12:51037161-51037183 CCTTTAAAGAAGCAAGTGGGGGG - Intergenic
1097272015 12:57781457-57781479 TCTAAAAAGCAGGAAATGGGTGG - Exonic
1098247593 12:68536174-68536196 CCTTGAACCCAGGAAGTGGAGGG + Intergenic
1098445974 12:70565904-70565926 CCTTAAAAGATGGAAGAGGGAGG + Intronic
1098501839 12:71202090-71202112 CTTTATGAGAAGGAAGTGGATGG + Intronic
1098565089 12:71925417-71925439 CCTGAATAGCAGGAAATGAAAGG - Exonic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1099723597 12:86396643-86396665 GCAGAAAAGCAGGAAGTGGCAGG + Intronic
1100261035 12:92932206-92932228 ACTTGAAGGCAGGAGGTGGATGG + Intergenic
1100908304 12:99328133-99328155 ACTGAAAAGCAGGAAATGAAGGG + Intronic
1102442489 12:112974503-112974525 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1104787782 12:131460807-131460829 TCATAAAGGCAGGAAGGGGAGGG + Intergenic
1105538478 13:21292891-21292913 CCTTAAAACCTGGATTTGGATGG - Intergenic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1107195049 13:37641652-37641674 CCTAGAAAGTAGGAACTGGAAGG - Intronic
1107514765 13:41118473-41118495 GCTTGAACGCAGGAGGTGGAAGG - Intergenic
1107642097 13:42454002-42454024 CCTTGAATCCAGGAGGTGGAGGG - Intergenic
1111820616 13:93209346-93209368 CCTTATAAGAAGGAAGTAGGAGG - Intergenic
1113264930 13:108606826-108606848 CCATGAAAGCAGGGAGTGGAAGG + Intronic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1114030031 14:18570231-18570253 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1114660672 14:24341787-24341809 CTTTAAAAGAAGGAAGAGCAGGG + Intergenic
1115628663 14:35221107-35221129 GCTCTAAAACAGGAAGTGGATGG - Intronic
1115799565 14:36977278-36977300 CCTTCATAGCAGGAAGGGGAAGG - Intronic
1116079966 14:40158946-40158968 GCTTAAACCCGGGAAGTGGAGGG + Intergenic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1119749415 14:77066930-77066952 CCTCATTAGCAGGAAGTGGGAGG + Intergenic
1121513346 14:94530936-94530958 CCTTCATACCAGGAAGTGGTGGG - Intergenic
1121978674 14:98432379-98432401 CCTTACAAGCAGGAAATGACAGG - Intergenic
1122057949 14:99117861-99117883 CCTCAAAGGCAGCAAGGGGACGG - Intergenic
1123163889 14:106307150-106307172 CCCTAAAAGAGGGAAGTGCATGG + Intergenic
1124911133 15:33921916-33921938 CCTTAAGAGCAGGGAGCGGAGGG + Intronic
1126739169 15:51760431-51760453 TCTTAAAAGATGGAAGAGGAAGG - Intronic
1126776125 15:52102113-52102135 CCTTAAGATGAGGAAGAGGAGGG - Intergenic
1127759613 15:62125675-62125697 CCTTAAAAGAAGTGACTGGAAGG - Intergenic
1127778717 15:62292042-62292064 CATTTAAAGCAGGGTGTGGAGGG - Intergenic
1128201750 15:65814940-65814962 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1131020157 15:89090668-89090690 CGTTAAAAGCAGGCAGTGAGGGG + Intronic
1131511443 15:93051474-93051496 CCCCAAAAGCAGGTAGGGGAGGG + Intronic
1131866392 15:96715828-96715850 CATTAAAGGCAGTAAGTGGTAGG + Intergenic
1132015872 15:98316047-98316069 CATTAAAAGCAGGCAGGGCATGG - Intergenic
1132847545 16:2007374-2007396 CCTTACAGGCAGGCAGTGGGAGG - Intronic
1133235683 16:4386380-4386402 CCTGGAAGGCAGGAAGTGGTGGG + Intronic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1133821429 16:9240558-9240580 CTTTAACACTAGGAAGTGGATGG + Intergenic
1134216355 16:12319814-12319836 ACTTCAAAGCAGGAAGGGGGAGG + Intronic
1134602927 16:15547641-15547663 CATTAAAAGCTGAAAGTGGCTGG - Intronic
1134987766 16:18669709-18669731 CATTAAAAGCAGCATGTAGAGGG - Intergenic
1137246580 16:46710954-46710976 CATTAAAGGGAGGAAGCGGAAGG + Intronic
1137449251 16:48555393-48555415 CCTTGAGAGCAGGAAGAGGCTGG + Intronic
1137497238 16:48979982-48980004 CCTCAAAATCCTGAAGTGGAAGG - Intergenic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1138078244 16:54063921-54063943 CCTTAAAAGCAGTCAGAAGAAGG - Intronic
1138439921 16:57028072-57028094 CTTTAAGAGCAGGAAGTGTGGGG + Exonic
1138670471 16:58610320-58610342 GCTTAAACGCAGGAGGTGGAGGG + Intronic
1138858496 16:60725341-60725363 CCTCAAAGGCAGGCACTGGAAGG - Intergenic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1141156424 16:81600454-81600476 CCTCAAAAACAGTAAGTGAAAGG + Intronic
1142202651 16:88768492-88768514 CCATAAAAACAGGATGTGGTGGG - Intronic
1142213292 16:88818536-88818558 GCCAAAAAGCAGGAAATGGAGGG + Intronic
1142387881 16:89778077-89778099 CCTTGAACCCAGGAGGTGGAGGG + Intronic
1145287470 17:21516992-21517014 CTTGAAAAGCAGGTCGTGGAGGG - Intergenic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1145984567 17:29036695-29036717 CCTTCAGACCAGGAGGTGGAGGG - Intronic
1146482018 17:33212402-33212424 CCCTAGAAGCCGGAAGAGGAAGG + Intronic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147706107 17:42425852-42425874 GCTTGAACCCAGGAAGTGGAGGG - Intergenic
1148454742 17:47804998-47805020 CCTCAACAGCTGGAAGTGGTGGG - Intergenic
1149247414 17:54727291-54727313 CCTGAAAAGGAGGAAGAGAAAGG - Intergenic
1149575964 17:57713790-57713812 CTTTAAAAGCAAGAATTGGGTGG - Intergenic
1149589314 17:57816905-57816927 CCCTAATAGCAGGAAATGGTAGG - Intergenic
1150422519 17:65051313-65051335 ACTTAAAAACAGGAGGTAGATGG + Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1152431121 17:80248724-80248746 CCTGAACAGCAGGGAGTGGGGGG - Intronic
1152929913 17:83104190-83104212 GCTTGCAGGCAGGAAGTGGAGGG - Intergenic
1153329685 18:3861350-3861372 CCTTAAAAGCATAAAATTGATGG - Intronic
1153472453 18:5462426-5462448 ACTAGAAAACAGGAAGTGGAAGG - Intronic
1156055778 18:33000570-33000592 TCTTAAAAGCAGCAAGAGAAAGG + Intronic
1156889649 18:42175985-42176007 ACTTGAAAGCATGAGGTGGAAGG - Intergenic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1157365937 18:47064382-47064404 CCTAAGAAGCAGGGAGTGGTGGG + Intronic
1158277202 18:55781062-55781084 TCTTGAAAGCAGTAAATGGAGGG + Intergenic
1158405915 18:57158968-57158990 CCTTAAAAGTAGAAATTGGGAGG - Intergenic
1158905018 18:62003393-62003415 CCTTACAAAAAGGAGGTGGAGGG - Intergenic
1160071413 18:75631771-75631793 CCTTAATAGCAGGTACAGGAAGG + Intergenic
1160431334 18:78814853-78814875 CCCAAACAGCAGGAACTGGAGGG + Intergenic
1161137965 19:2631694-2631716 TTATAAAAACAGGAAGTGGAGGG + Intronic
1161857653 19:6774835-6774857 ACTTGAACCCAGGAAGTGGAGGG - Intronic
1163112606 19:15170552-15170574 CCCTAAGAGCAGGAAGCAGAGGG + Exonic
1163492860 19:17627081-17627103 ACTTGAACCCAGGAAGTGGAGGG + Intronic
1163901933 19:20109980-20110002 TCATAAAATCAGAAAGTGGAAGG - Intronic
1163947118 19:20548456-20548478 TCATAAAATCAGAAAGTGGAAGG + Intronic
1163985258 19:20940691-20940713 TCATAAAAACAGAAAGTGGAAGG - Intronic
1163995027 19:21036969-21036991 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164008321 19:21172948-21172970 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164068289 19:21741208-21741230 TCATAAAAACAGAAAGTGGAAGG + Intronic
1164239382 19:23370344-23370366 TCATAAAAACAGAAAGTGGAAGG + Intronic
1164285602 19:23813392-23813414 TCATAAAAACAGAAAGTGGAAGG - Intronic
1167043084 19:47034229-47034251 ACTTGAACCCAGGAAGTGGAGGG + Intronic
1167761566 19:51453169-51453191 CCTTGAGCCCAGGAAGTGGAGGG - Intronic
925306938 2:2854490-2854512 CCTTGTAAGCAGGACATGGAAGG - Intergenic
925601699 2:5614450-5614472 CCTTAAGATCTGGAAGTAGAGGG + Intergenic
930860065 2:56062808-56062830 CATTTAAAGCAGTATGTGGAGGG - Intergenic
931378273 2:61727667-61727689 CCTTAGAAGCAGGGAGGGAATGG + Intergenic
932293982 2:70609189-70609211 TGTTCAAGGCAGGAAGTGGAAGG - Intronic
933019237 2:77170198-77170220 CCTTAAGAGTGGGAAGAGGAAGG + Intronic
935253059 2:101282562-101282584 TCTTTAAAGCAGCAAATGGAAGG - Intronic
935413127 2:102786854-102786876 ACTCACAATCAGGAAGTGGAGGG + Intronic
937403814 2:121609644-121609666 CCTTAAAAGCAAGTAATGGCCGG + Intronic
938043246 2:128093725-128093747 CTTTAAAAGCAGGAAGGTGTGGG + Intronic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
938670416 2:133581324-133581346 CCCTTACAACAGGAAGTGGATGG - Intergenic
938831481 2:135053912-135053934 CCTTGAAAGTGGGAAGTGGTTGG + Intronic
939082116 2:137674661-137674683 CCTGGAAAGCAGGAAATTGAAGG + Intronic
939683314 2:145166501-145166523 CCTTAGAAAGAGGAGGTGGAGGG - Intergenic
939971343 2:148664637-148664659 CCTGAAGACCAGGAGGTGGAGGG - Intronic
940405202 2:153293336-153293358 CCTTAAAAGATGAAAGAGGAAGG + Intergenic
940606822 2:155935292-155935314 CCTTAAACGCTGGACGGGGAGGG - Intergenic
942648566 2:178142794-178142816 CCTTGAAAGAATGAGGTGGAAGG + Intergenic
943224894 2:185159706-185159728 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
943929712 2:193834020-193834042 CCTTTAAAGCAGTATGTAGAGGG - Intergenic
945033756 2:205686816-205686838 CCGAAAGAACAGGAAGTGGAGGG - Intronic
945459369 2:210087317-210087339 TCTTAAAAGCAACAAGAGGATGG - Intronic
945945050 2:215987582-215987604 TTTTAAAAGAAGAAAGTGGAAGG + Intronic
946961776 2:224993061-224993083 ACTGAAAATCAGGCAGTGGAAGG + Intronic
947220409 2:227786353-227786375 CCATAAAAGGAGAAAGTTGATGG - Intergenic
948743595 2:240067716-240067738 CCTTAAAATATGGAAGAGGAAGG + Intergenic
1168892091 20:1301183-1301205 CCTCCACAGCAGGAAGTAGATGG - Intronic
1169829697 20:9810460-9810482 CCTTGAGCCCAGGAAGTGGAAGG + Intronic
1169999449 20:11598146-11598168 ACCTTAAAGCAGGAAGTGAAAGG - Intergenic
1170054819 20:12190105-12190127 CATTAAAATTAGGAAGTGTATGG + Intergenic
1172394223 20:34588167-34588189 ACTTGAAACCAGGAGGTGGAGGG + Intronic
1173204016 20:40978257-40978279 CCCTAAAAGCAGCAAGAGAAAGG - Intergenic
1174479033 20:50818063-50818085 CTTTCAAAGGAGGCAGTGGAAGG + Intronic
1174884708 20:54320768-54320790 TCTTATCAGCAGGAAATGGAGGG + Intergenic
1175713111 20:61236821-61236843 CCTCCAAAGCAGGAAGAAGAGGG - Intergenic
1176046946 20:63097643-63097665 CCTCCTAAGCAGGACGTGGAGGG - Intergenic
1176227916 20:64013307-64013329 CCTTAAAAGAAGGCATTAGAGGG - Intronic
1176997637 21:15575769-15575791 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
1177386058 21:20410815-20410837 ACTTAAAATCTGTAAGTGGAAGG - Intergenic
1178343279 21:31804137-31804159 CCCTGAAAGGAGGAAGTGGCTGG + Intergenic
1179011339 21:37558550-37558572 CCTTAAAAGATTGAAGAGGAAGG - Intergenic
1179512395 21:41882052-41882074 TCTTAAAAGCTGGAGGTGGCTGG - Intergenic
1179611251 21:42552783-42552805 GCTGAAAAGCAGGAAGAAGAGGG + Intronic
1180454146 22:15497281-15497303 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1182132858 22:27870829-27870851 CCTCCACAGCAGCAAGTGGATGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182746046 22:32606193-32606215 CCTTGGAAGCAGGAAGGGAAGGG + Intronic
1183263333 22:36810460-36810482 CCTCAAAAGCATGAAGTGTGGGG + Intronic
1184325459 22:43780188-43780210 CCTTAAGAGCAGGAACAGGCTGG + Intronic
1184355972 22:43979913-43979935 TCTTAAAGGCAGGGAGTGGGAGG - Intronic
949848962 3:8402162-8402184 GCTTCAAAGCAGGAAGTCAATGG - Intergenic
950667468 3:14506065-14506087 TCCCAAAGGCAGGAAGTGGAGGG - Intronic
950831176 3:15877854-15877876 CCTTAAGGGGAGGGAGTGGATGG + Intergenic
951317086 3:21201388-21201410 CCTTACAAGCAGGAAGAGAATGG - Intergenic
951404248 3:22275326-22275348 CCTTGAAAGCAGGAAGATAATGG + Intronic
951781521 3:26368581-26368603 CAGTAAAAGGAGGAAGTGGGGGG + Intergenic
952030919 3:29141822-29141844 ACTTAAAAACAGGAAGGAGAGGG - Intergenic
952784996 3:37144241-37144263 CCTTAATAGGAGGAAGGAGAGGG + Intronic
953105571 3:39875492-39875514 CATTCAAAGCAGGATGTAGAGGG - Intronic
954233035 3:49233453-49233475 CCTTAATGCCAGGAACTGGAGGG + Intronic
954632060 3:52053004-52053026 CTTTAACAACAGGAAGTGGGAGG - Intronic
956092442 3:65682271-65682293 CCTACAAAGAAGGAAGTGGGAGG + Intronic
956436370 3:69238026-69238048 CCTTAAGAGCCCAAAGTGGATGG - Intronic
957151351 3:76490141-76490163 CATAAAAAGGAGGAAGTGGAAGG - Intronic
958119822 3:89270956-89270978 GCTGAAAAGGAGGAAGGGGAGGG + Intronic
961851218 3:129820861-129820883 GCTTAAAAGTAGGAAGTGAGAGG - Intronic
962273277 3:133993901-133993923 CCTTGAAGGCAGGAAGAGAAGGG - Intronic
962406347 3:135103824-135103846 CCATGAGAGGAGGAAGTGGAGGG - Intronic
963876462 3:150480940-150480962 CCATAATACCAGGAAATGGAAGG + Intergenic
964489123 3:157216224-157216246 TGATAAAAGCAGGAGGTGGAAGG - Intergenic
965811885 3:172599898-172599920 CCTTATAAGGAGCAGGTGGAGGG - Intergenic
966273989 3:178142452-178142474 CCATAAAAGCAGGGACTGGCTGG + Intergenic
966766749 3:183470061-183470083 ACTTGAACCCAGGAAGTGGAGGG - Intergenic
967662915 3:192135194-192135216 TTCTAAAAGCAGGAATTGGAGGG - Intergenic
969498552 4:7539919-7539941 CCTTCACAGCAGGAAGGGGGTGG - Intronic
970236531 4:13964368-13964390 GCTGAAAAGGAGGAAGAGGAGGG - Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
971255157 4:25007831-25007853 CCTGCAAAGGAGGAAGTGCATGG + Intronic
971575315 4:28265375-28265397 CATTAAAAGAGGGAAGTAGAGGG - Intergenic
972104629 4:35467644-35467666 CCTTAAAAGCAGCAACTTGGGGG - Intergenic
972249484 4:37284639-37284661 GCTTAAAAGTAGGAAGTAAAAGG + Intronic
972388010 4:38586521-38586543 CCTTAAAAGAAGGAAGAGGGAGG - Intergenic
974891519 4:67889972-67889994 ACATGATAGCAGGAAGTGGAGGG - Intergenic
975343610 4:73269122-73269144 CTTTAAAAGATGGAAGAGGAAGG - Intergenic
976019759 4:80607384-80607406 TCTTAAAAGCAAAAAGTAGAGGG + Intronic
976235806 4:82895550-82895572 CTTTAAAAGCTGGAAGAGTAAGG + Intronic
976269373 4:83215917-83215939 CTTTAAAATCAGGAAGTGTGAGG - Intergenic
976496430 4:85735058-85735080 CCTGAAAAGGTGGGAGTGGAAGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
978283480 4:107045534-107045556 ACTCAAACCCAGGAAGTGGAGGG + Intronic
978902695 4:113971824-113971846 CCTTGAATGAAAGAAGTGGATGG + Intronic
980021934 4:127721300-127721322 CCTTATAAGCTGGAAGAGGTTGG - Exonic
980874749 4:138650133-138650155 CCTTTGAAGTAGGAAGTAGACGG - Intergenic
981140417 4:141261061-141261083 TCATAAAAGCAGGAAGAGAAAGG + Intergenic
983094473 4:163545196-163545218 CCTTTAAAGCATGAAGGAGATGG - Intronic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
984830100 4:183964931-183964953 CCTCAGAAACAGGAAATGGAAGG + Intronic
985967763 5:3350800-3350822 TCTTAAGCCCAGGAAGTGGAGGG - Intergenic
987837838 5:23184642-23184664 CTTTAGAAGCAAGAATTGGAAGG - Intergenic
988516659 5:31910824-31910846 GGTTAAAAGCAGGAACTGGCTGG - Intronic
989384023 5:40836854-40836876 CCTTAAAAGTAGGAGAAGGATGG - Intergenic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
992420917 5:76603542-76603564 GGTTCAAAGCAAGAAGTGGAAGG - Intronic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994016229 5:94969115-94969137 CTTTAAAAAGAGGAATTGGACGG + Intronic
994195544 5:96918882-96918904 CCTTAAAAGAAGGAGGTGGGGGG - Exonic
994395510 5:99223216-99223238 CCTAATAAGCAGGGAGGGGAAGG - Intergenic
995336080 5:111001382-111001404 ACTGAAAAGCAGGAAGGGCAAGG + Intergenic
995750114 5:115444933-115444955 CATTTAAAGCAGGGAGTAGAGGG + Intergenic
996044745 5:118858909-118858931 ACTTAAAAGAAGGAATTGGATGG - Intronic
996587068 5:125101118-125101140 CCTATAAAACAGGAAGTGAAAGG - Intergenic
998001387 5:138628888-138628910 GCTTAAACCCGGGAAGTGGAGGG - Intronic
1001082344 5:168676551-168676573 TGGTAAAAGCAGGAAGGGGAGGG + Intronic
1001122356 5:168991315-168991337 CCTCCAAAGGAGGAAGTGGTAGG + Intronic
1001398603 5:171433556-171433578 CCTGAGCAGCAGGATGTGGAAGG + Intronic
1002015924 5:176322695-176322717 CCTGAAATGCAGGAAGTGAAGGG - Intronic
1002988751 6:2217855-2217877 CTTTAAAAGAAGGATGTGTAGGG - Intronic
1003208653 6:4038876-4038898 CCTTTAAAGCAGGGAGTTTATGG + Intronic
1003747305 6:9017133-9017155 CCTCAAAATCAGGAGGAGGATGG - Intergenic
1004440965 6:15653472-15653494 ATTTAAAAGCAGCAAGTAGAGGG - Intronic
1006233426 6:32605448-32605470 CCTTGAACCCAGGAGGTGGAGGG + Intergenic
1006307862 6:33235501-33235523 ACTTAACGCCAGGAAGTGGAGGG + Intergenic
1007096305 6:39215311-39215333 CCTTCAGAGCAGCGAGTGGAAGG - Intronic
1007234423 6:40380023-40380045 CCTTCAAAGGGGGAAGTGGGAGG - Intergenic
1007857017 6:44868409-44868431 CCTTAAAAGGCTGAAATGGATGG - Intronic
1008094095 6:47321227-47321249 CTTGTAAAGAAGGAAGTGGAGGG - Intergenic
1008122971 6:47638779-47638801 CATTTAAAGCAGGGAGTAGAGGG - Intergenic
1008365289 6:50671997-50672019 CCTTTAAAGCAGGCAGAAGAGGG + Intergenic
1008448665 6:51623664-51623686 GCTTGAAACCAGGAGGTGGAGGG - Intronic
1009324765 6:62337309-62337331 CTTTAAAAGCAGAAACTAGATGG + Intergenic
1010280431 6:74017482-74017504 TCATAAAGGCAGGGAGTGGAAGG - Intergenic
1011432062 6:87298040-87298062 CCTTGAAAGCAGGTATTGGCTGG + Intronic
1011881011 6:92026881-92026903 AGTTAAAAGAAGGAAGTGGTAGG - Intergenic
1013509643 6:110832801-110832823 CCTAAAAAACAAAAAGTGGATGG - Intronic
1015585405 6:134771058-134771080 ACTGAAAAGCAGGACGTGGCTGG - Intergenic
1015823404 6:137286645-137286667 CCTTAAATGCAGTAAATTGAAGG + Intergenic
1016050869 6:139528741-139528763 ACTTAAAAACAGGAAATGAAGGG + Intergenic
1017815376 6:158012374-158012396 CCTTAAAAGCTGGAAGAGGGAGG + Intronic
1018256996 6:161930788-161930810 CCTTAAAAGGTAGAAGGGGAAGG + Intronic
1018453321 6:163929303-163929325 CCACAAAAGCAAGAAGTGAAAGG - Intergenic
1018880322 6:167872232-167872254 CCTGAAAAGCAGGAAAAAGAAGG + Exonic
1019571244 7:1713486-1713508 CCTTGAACACAGGAAGTGGAGGG - Intronic
1022788771 7:33665507-33665529 CCTTAAAATCAGGAAGGGCTTGG + Intergenic
1022816141 7:33916355-33916377 CCATTAAATCAGGAAGTGGCAGG + Intronic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1023321530 7:39003437-39003459 TCTTAAAAGAAGGAAGTGATTGG + Intronic
1023409972 7:39880506-39880528 CATTAAAGGAAGGAAGAGGAGGG - Intergenic
1024624373 7:51192039-51192061 CCTGAGAAGCAGGAAGTCAAGGG + Intronic
1026068123 7:67093468-67093490 CCTAAAACTCAGAAAGTGGAAGG - Intronic
1026708798 7:72718839-72718861 CCTAAAACTCAGAAAGTGGAAGG + Intronic
1027156490 7:75772003-75772025 CCTAAAAATCAGGGAGAGGAAGG + Exonic
1028041135 7:86056495-86056517 CCTTATAAGCAGGAAGAGATTGG - Intergenic
1029280312 7:99431210-99431232 ACTTGAACCCAGGAAGTGGAGGG - Intronic
1029595758 7:101536895-101536917 ATGTAAAGGCAGGAAGTGGAGGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030085230 7:105810250-105810272 CTTTCACAGCAGGAAGAGGATGG + Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030549825 7:110944588-110944610 CCTTTAGAGAAGGAACTGGAGGG - Intronic
1030951664 7:115798242-115798264 CCTGAAAAGATGGAAGAGGAAGG + Intergenic
1031509835 7:122636425-122636447 CCTTACGAGCCGGAAGAGGATGG - Intronic
1031557470 7:123195506-123195528 CCCTAGAAGGAGGAAGTGGTAGG - Intronic
1031914901 7:127553865-127553887 CCTTCACTGTAGGAAGTGGAAGG + Intergenic
1033535504 7:142308394-142308416 CCTTTAAAGGAGCAAGTGCAGGG + Intergenic
1034433707 7:151053291-151053313 CCTTACTGGCAGGAAGAGGAAGG - Intergenic
1035228564 7:157446934-157446956 CCTTAAAGCCAGGATGAGGAGGG - Intergenic
1036900217 8:12664792-12664814 ACGTAAAAGAAGGAGGTGGAAGG + Intergenic
1037386301 8:18346110-18346132 CCATAAAATCAAGAAGTGGCAGG + Intergenic
1037418210 8:18674061-18674083 CCTTGAGCCCAGGAAGTGGAGGG + Intronic
1037667084 8:20979054-20979076 CCTTAAAAGAAGGGAAGGGATGG + Intergenic
1037746142 8:21646494-21646516 CATTAAGTGCAGGATGTGGACGG - Intergenic
1038108681 8:24467980-24468002 CCTTGAACCCAGGAGGTGGAAGG + Intronic
1039378739 8:37064414-37064436 ACTTAAATTCAGGAAGTGTAAGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040623746 8:49120078-49120100 TCTTAAAAGAATGAGGTGGAAGG - Intergenic
1042281639 8:67062434-67062456 CCTTAAGAGCGGGATGTGGAGGG + Intronic
1042921819 8:73927666-73927688 ACTTGAAACCAGGAGGTGGATGG - Intergenic
1046778330 8:118188001-118188023 CCTAAAAAGAAGGAAGGAGAAGG + Intergenic
1046924391 8:119770408-119770430 CCTTACAAGCAGGAAGAGATTGG + Intronic
1047728768 8:127708345-127708367 GCTGAAAAGCAGGAACTGGAAGG + Intergenic
1048927367 8:139282952-139282974 GCTTAAAATCAGGAAGTGATTGG + Intergenic
1050119756 9:2296101-2296123 CTTGAAAAGCAGGAAGAAGACGG + Intergenic
1052676085 9:31626571-31626593 CCTTAAGAGCAGGAAGAAGCAGG + Intergenic
1052763088 9:32612599-32612621 GATTATAAGCAGGAAGTGGGGGG - Intergenic
1054830904 9:69623504-69623526 GATTTAAAGCAGGAAGTGGATGG + Intronic
1055827198 9:80340901-80340923 CCCTAAAAGCAGTAAGAGGCTGG + Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1058484419 9:105429203-105429225 CCTTAAAAGGAAGAACTGAAAGG + Intronic
1059235747 9:112759416-112759438 ACCTTAAAACAGGAAGTGGAGGG - Intronic
1061191513 9:129085285-129085307 CCTTAAATACAGGAAAAGGAAGG - Exonic
1062209876 9:135357678-135357700 GCTTGAACCCAGGAAGTGGAGGG - Intergenic
1186808945 X:13167990-13168012 CTCTGAGAGCAGGAAGTGGAAGG - Intergenic
1186986333 X:15018275-15018297 TATCCAAAGCAGGAAGTGGAGGG + Intergenic
1188354426 X:29174001-29174023 CCTTGAACCCAGGAGGTGGAGGG - Intronic
1188384744 X:29542309-29542331 ACTGGAAAGCAAGAAGTGGAAGG - Intronic
1190528955 X:51355676-51355698 CCTCAGAACCAGGAAGTAGATGG + Intergenic
1190569994 X:51770935-51770957 CTTTAAAAGGAGGAACTGGCTGG - Intergenic
1194414003 X:93588352-93588374 CTGTAAAAGCAGGAAGAGAAAGG + Intergenic
1196390189 X:115198890-115198912 CCTTAAAAGCCAGAAGAGAAGGG + Intronic