ID: 1088640760

View in Genome Browser
Species Human (GRCh38)
Location 11:111871089-111871111
Sequence GCCCACTCTAGGCCTGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 0, 3: 52, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088640757_1088640760 -10 Left 1088640757 11:111871076-111871098 CCACAGAGGCTGTGCCCACTCTA 0: 1
1: 0
2: 1
3: 21
4: 185
Right 1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG 0: 1
1: 0
2: 0
3: 52
4: 369
1088640753_1088640760 27 Left 1088640753 11:111871039-111871061 CCGTAAAAGGTATACTCTTTGAT 0: 1
1: 0
2: 2
3: 16
4: 187
Right 1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG 0: 1
1: 0
2: 0
3: 52
4: 369
1088640756_1088640760 -9 Left 1088640756 11:111871075-111871097 CCCACAGAGGCTGTGCCCACTCT 0: 1
1: 0
2: 0
3: 31
4: 247
Right 1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG 0: 1
1: 0
2: 0
3: 52
4: 369
1088640754_1088640760 4 Left 1088640754 11:111871062-111871084 CCTGTCTACATCTCCCACAGAGG 0: 1
1: 0
2: 1
3: 21
4: 365
Right 1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG 0: 1
1: 0
2: 0
3: 52
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088640760 Original CRISPR GCCCACTCTAGGCCTGGCCC AGG Intronic
900394130 1:2446221-2446243 GCCCACTCTGGGGCTGTCACAGG + Intronic
900596915 1:3484105-3484127 GCCGGCTCCAGGGCTGGCCCTGG + Intergenic
901127862 1:6941841-6941863 GTCCACTATAGGCATGGCCAGGG + Intronic
902248381 1:15136956-15136978 ACCCACTCTAGACCAGGCTCTGG - Intergenic
902799663 1:18821372-18821394 GCCCACACCAGGCCTTGCCCTGG + Intergenic
903007467 1:20308307-20308329 GCCCACACTGTCCCTGGCCCAGG - Intronic
903646009 1:24896911-24896933 GCCTGCCCTGGGCCTGGCCCAGG - Intergenic
903847918 1:26289512-26289534 AGCCACTCTGGGCCAGGCCCAGG - Intronic
903850420 1:26302492-26302514 CCCCACACAGGGCCTGGCCCAGG + Intronic
903994755 1:27298773-27298795 TCCATCTCTAGTCCTGGCCCTGG - Intronic
904115261 1:28157044-28157066 TTTCACTCTAGTCCTGGCCCTGG - Intronic
904339255 1:29823492-29823514 GTCCACTCTATGTCAGGCCCTGG + Intergenic
904450899 1:30610785-30610807 GCCCACTATGGGCCTGGCACTGG - Intergenic
905257539 1:36694575-36694597 GCCCTCTCTCGGCCTGTCTCAGG + Intergenic
905485522 1:38293026-38293048 TCCCACTCCAAGCCAGGCCCTGG - Intergenic
905886484 1:41494711-41494733 GCCCACTCTGTGTCAGGCCCAGG + Intergenic
905891698 1:41522122-41522144 GCCACCTCCAGGCCTGCCCCAGG - Intronic
906263228 1:44408250-44408272 CCGCACTCTCGGACTGGCCCGGG + Intronic
906315802 1:44785735-44785757 GCACAAACTAGGCCTGGGCCTGG + Intronic
907272647 1:53299913-53299935 GCCCACTCTGGGCCTGGTGGTGG - Intronic
907321762 1:53606962-53606984 GCTCACTCTGGCCCTGGACCGGG - Intronic
908012304 1:59791083-59791105 GCCCACCCAAGGCCTGCCACTGG + Intergenic
908456760 1:64311809-64311831 CCCTACCCTAGCCCTGGCCCTGG + Intergenic
911975294 1:104487360-104487382 GCCCACCCCAGGACAGGCCCTGG + Intergenic
912209816 1:107545437-107545459 GCCCACTAGAGGCCTGCCCCAGG - Intergenic
914825955 1:151138180-151138202 CCCCTACCTAGGCCTGGCCCTGG + Intronic
916138850 1:161676061-161676083 GGCCACCCAAGCCCTGGCCCAGG + Intronic
916879038 1:169000949-169000971 GTCTTCTCTGGGCCTGGCCCTGG + Intergenic
917547287 1:175984210-175984232 GCCAACCCTGGACCTGGCCCAGG - Intronic
919463868 1:197909607-197909629 GCGCTCTCTGGGCCTGGCGCAGG + Intergenic
922667816 1:227487788-227487810 GGGGCCTCTAGGCCTGGCCCAGG + Intergenic
922695913 1:227730978-227731000 GCCCACACTCAGCCTGGGCCTGG + Intronic
922785841 1:228281863-228281885 GCCCTTCCTAGGTCTGGCCCAGG + Intronic
923047868 1:230368712-230368734 CCTCACCCTAGACCTGGCCCAGG - Intronic
923543661 1:234908494-234908516 GCCCAGGCTAGGCAGGGCCCTGG + Intergenic
924452026 1:244187126-244187148 TCCAACTCTGGGCCTGGCCCAGG - Intergenic
1063391619 10:5653231-5653253 GCCCCTTGTAGGCCTTGCCCAGG - Intronic
1065819989 10:29516722-29516744 GCTCACCCAACGCCTGGCCCAGG + Intronic
1065952929 10:30668163-30668185 GCTCACCCAACGCCTGGCCCTGG - Intergenic
1066197572 10:33116044-33116066 GCCCACCGTAGGGCTGGCCACGG - Intergenic
1066370652 10:34815580-34815602 GCCCCCACCAGCCCTGGCCCAGG + Intergenic
1067239358 10:44477147-44477169 GCTCACTCTGAGCCTGGTCCAGG + Intergenic
1067344807 10:45429314-45429336 GCCCAGTCCAGTCCTGGCCTTGG - Intronic
1067681687 10:48445706-48445728 GCCCACTCAGGCTCTGGCCCTGG + Intergenic
1067804311 10:49382551-49382573 GCCCAATCTAGGCCTGGGCAAGG - Intronic
1069753926 10:70761892-70761914 GTCCACTCATAGCCTGGCCCTGG + Exonic
1069868883 10:71521257-71521279 GCCCACTCACGTCCTTGCCCCGG + Intronic
1070103898 10:73414063-73414085 GCCCACCCTGGGCCCGCCCCCGG - Exonic
1070781999 10:79143104-79143126 GCCCCCTCCAGGCCAGGCCCCGG + Intronic
1071291229 10:84190741-84190763 AGCCACTCTACACCTGGCCCGGG + Intergenic
1072107928 10:92291435-92291457 ACCCGCTCAAGGCCAGGCCCAGG - Exonic
1072298971 10:94040658-94040680 TCCCACTCTAGTCCTAGCCTTGG + Intronic
1072782396 10:98259640-98259662 CCCCACTCTAGGACTGGCCGAGG - Intronic
1073152418 10:101321161-101321183 GCCCTCTGAAGGCCTGGCACAGG - Intergenic
1073435081 10:103511298-103511320 CCCCTCTCTTGGCCTGGCCATGG + Intronic
1074111212 10:110423856-110423878 GCCCACCCAGGGCCTGCCCCTGG - Intergenic
1075244039 10:120804641-120804663 ACCCACTGTATGCCAGGCCCTGG + Intergenic
1076664605 10:132079099-132079121 GGCCACTGTAAGCCGGGCCCAGG - Intergenic
1077369414 11:2174519-2174541 CCCGACTCCAGTCCTGGCCCTGG + Intergenic
1077524026 11:3053600-3053622 GTCCACTCCAGGCATGGCCCTGG + Intronic
1078023648 11:7674235-7674257 GCCTACCCTGGGCCTGGTCCGGG + Intronic
1078416448 11:11170137-11170159 GCCCACTCTTCCCCTGGCCAGGG - Intergenic
1078771857 11:14358917-14358939 GCCCGCCCTAGGCCCGGCTCCGG + Exonic
1079138083 11:17787714-17787736 GGCTGCTCTAGGCATGGCCCAGG + Intergenic
1080317235 11:30964096-30964118 GCACACCCTAGGAGTGGCCCTGG - Intronic
1080395465 11:31886034-31886056 GTGCCCTCCAGGCCTGGCCCAGG + Intronic
1081749555 11:45500160-45500182 GCCCTTTCTAGGCCTGACACTGG + Intergenic
1082001354 11:47395162-47395184 GGCCAAAGTAGGCCTGGCCCTGG - Intergenic
1083165863 11:60887043-60887065 GCCCACCCCAGGACAGGCCCTGG - Intergenic
1083266074 11:61547399-61547421 GCCCACTGTGTGCCCGGCCCCGG - Intronic
1083599723 11:63939259-63939281 CCCTACGCTAGGCCTAGCCCGGG + Intronic
1083779347 11:64910003-64910025 ACCCACCCCCGGCCTGGCCCTGG + Intronic
1083945472 11:65920469-65920491 CCCCACTGTATGCCAGGCCCTGG - Intronic
1084195393 11:67521650-67521672 GCCCACTGTGTGCCTGGCCCTGG - Intronic
1084380027 11:68805865-68805887 GCCCATTGTAGTCATGGCCCTGG - Intronic
1084474487 11:69381059-69381081 GGCCACTCCAGGCCGGCCCCAGG - Intergenic
1084569775 11:69952199-69952221 GCCCACCCCTGCCCTGGCCCAGG - Intergenic
1084654170 11:70505590-70505612 GCCCCCTCAAGGCCCGGCACTGG - Intronic
1084684757 11:70687002-70687024 GCCCACTCTGGGTCAGGCCCTGG + Intronic
1084705898 11:70815817-70815839 GCCCACTGCAGTCCTGGCCAAGG + Intronic
1085078645 11:73614964-73614986 GCCTACTCTTTGCCAGGCCCTGG + Intergenic
1086152736 11:83630299-83630321 CCCAACTCTAGCCCTGGTCCTGG - Intronic
1088640760 11:111871089-111871111 GCCCACTCTAGGCCTGGCCCAGG + Intronic
1089187978 11:116633932-116633954 CCTCACCCTAGTCCTGGCCCTGG - Intergenic
1089665032 11:120012964-120012986 GCTCACTGGAGTCCTGGCCCTGG + Intergenic
1089690084 11:120181738-120181760 GCCCACTCTGAGCCAGGTCCTGG + Intronic
1090135281 11:124191504-124191526 GCCCACTCTATTCTTGGCACTGG - Intergenic
1091282652 11:134390852-134390874 ACCCACCCTGCGCCTGGCCCAGG - Exonic
1091756462 12:3055692-3055714 ACCCACCCTAGCACTGGCCCTGG + Intergenic
1092230705 12:6773985-6774007 ACATACTCGAGGCCTGGCCCAGG - Exonic
1092917775 12:13203651-13203673 CCCCACTCTGTGCCTGGCACAGG + Intronic
1094253996 12:28400356-28400378 CCCCACCCTAGGACTGGCCCAGG + Intronic
1096078383 12:48818566-48818588 CCCCTCTCCCGGCCTGGCCCGGG + Intronic
1096533241 12:52255028-52255050 GCCTACTCTATGCCAGGCGCAGG + Intronic
1097178395 12:57156714-57156736 GCCTTCTCAAGGCCTGGCACAGG + Intronic
1097287254 12:57887921-57887943 GGTCACACTAGGCTTGGCCCAGG - Intergenic
1102520089 12:113472492-113472514 CCCCACCCTGGGCCTGGGCCTGG - Intergenic
1102570745 12:113825604-113825626 CCCCAGGCCAGGCCTGGCCCAGG - Intronic
1103030310 12:117607150-117607172 GCCTCCCCTGGGCCTGGCCCAGG + Intronic
1103342788 12:120230016-120230038 GCATTCTCGAGGCCTGGCCCAGG + Intronic
1103909628 12:124345136-124345158 GCGCACCCTGGGCCTGACCCTGG + Intronic
1104217512 12:126748650-126748672 GCCCACTGTGGGCCTGAGCCTGG - Intergenic
1104665267 12:130643230-130643252 GCTCACACTCGCCCTGGCCCCGG + Intronic
1104978093 12:132561045-132561067 GCCCTCTGGGGGCCTGGCCCAGG - Intronic
1105805744 13:23950844-23950866 GCCCCTTCCAGGCCAGGCCCAGG + Intergenic
1106229029 13:27807593-27807615 GCCCACTGTGTGCCAGGCCCTGG - Intergenic
1106563245 13:30864369-30864391 TTCCCCTCTAGGCCAGGCCCTGG - Intergenic
1111220852 13:85204852-85204874 GCCCTCTCTGGGCCTGGCCGAGG + Intergenic
1112404979 13:99111436-99111458 GCACACTATATGCCAGGCCCTGG + Intergenic
1113656674 13:112072304-112072326 ACCCACGCTCGGCCTGGGCCCGG + Intergenic
1113671667 13:112179680-112179702 TCCTCCTCTAGCCCTGGCCCTGG + Intergenic
1113784881 13:112997206-112997228 GACCACTGTGGGTCTGGCCCAGG + Intronic
1113896594 13:113768512-113768534 GCCCCCTCTGTGCCTGGCCCAGG + Intronic
1113896603 13:113768536-113768558 GCCCCCTCTGTGCCTGGCTCAGG + Intronic
1114606280 14:24000494-24000516 GCCTACTCTAGGGCAGGTCCAGG + Intronic
1116084436 14:40217218-40217240 GCCCTCTCTGGGGCTGGCCGAGG - Intergenic
1116707329 14:48318941-48318963 GCCCACAATAGGGCTGGACCAGG - Intergenic
1116982651 14:51188080-51188102 CCCACCTTTAGGCCTGGCCCAGG + Intergenic
1119400389 14:74358628-74358650 GCCCACTGTGGGGCTGGCCCTGG - Exonic
1119400700 14:74360308-74360330 GCCCACTGTGAGGCTGGCCCTGG + Intergenic
1119555477 14:75549210-75549232 GCCCACAAGAGGCCAGGCCCTGG - Intergenic
1120501869 14:85307704-85307726 GCCAACACTAGGATTGGCCCTGG + Intergenic
1121450079 14:94001401-94001423 GCTCCCTCTAGGCCTTCCCCAGG - Intergenic
1121621124 14:95348989-95349011 CCTCACCCTAGACCTGGCCCAGG + Intergenic
1122174815 14:99909049-99909071 GCCCACCCCATGCCTGGCCCTGG + Intronic
1122234624 14:100324686-100324708 TCTCACTCTGTGCCTGGCCCTGG + Intronic
1122262672 14:100532006-100532028 GCCCACTCTGTGCCGGGGCCAGG - Intergenic
1122451959 14:101816223-101816245 CTCCACTCTAGGCCTTGCTCAGG + Intronic
1122768627 14:104087116-104087138 GCCCACTCTGCGCCCAGCCCAGG + Intronic
1122882822 14:104697665-104697687 TCCCCCTCTGGGCCTGGGCCTGG - Intronic
1122923910 14:104891214-104891236 GCCCTCTCCAGGCCAGGCGCTGG + Intronic
1123043321 14:105499437-105499459 TCCCGCTGTGGGCCTGGCCCTGG + Intronic
1123056040 14:105571334-105571356 GCCCACCCAAGGCCTGGCTCAGG + Intergenic
1123056601 14:105573922-105573944 GCCCACCCAAGGCCTGGCTCAGG + Intergenic
1123057344 14:105577609-105577631 GCCCACCCAAGGCCTGGCTCAGG - Intergenic
1123080472 14:105691459-105691481 GCCCACCCAAAGCCTGGCTCAGG + Intergenic
1123081608 14:105697863-105697885 GCCCACCCAAGGCCTGGCTCAGG - Intergenic
1124658752 15:31528322-31528344 GCCCCCTCTGGGTCTGTCCCTGG - Intronic
1125764138 15:42121832-42121854 GCTGGCTCTGGGCCTGGCCCTGG + Intergenic
1127311008 15:57752514-57752536 GCTCCCCCTAGTCCTGGCCCTGG + Intronic
1127960701 15:63888306-63888328 GCCCAGCCTCAGCCTGGCCCTGG + Intergenic
1129189464 15:73928905-73928927 CCTCACCCTAGTCCTGGCCCTGG + Intronic
1129256353 15:74336199-74336221 CCTCACTCTGGGCCTGGGCCTGG + Intronic
1129326101 15:74800990-74801012 GACCACTCTCGTCCTGCCCCAGG + Exonic
1129355420 15:74987617-74987639 TCCCAGCCTGGGCCTGGCCCTGG - Intronic
1129697913 15:77751080-77751102 GCCCACTCTGTGCCCCGCCCTGG - Intronic
1129787730 15:78320623-78320645 GCCCACTCTGTGCCATGCCCTGG + Intergenic
1129890001 15:79065633-79065655 GCCCAGCCTGGGCCTGGGCCTGG + Intronic
1130064988 15:80595778-80595800 GCCCATTCTGGGGCTGGCCCTGG - Exonic
1132004903 15:98218187-98218209 TCCCTCTCTCAGCCTGGCCCAGG - Intergenic
1132273198 15:100544478-100544500 GCCCTCTCTCGGCCTCGACCTGG + Intronic
1132629433 16:909871-909893 GCACACTCTGGCCGTGGCCCTGG + Intronic
1132747663 16:1443694-1443716 GCCCACTCTCGCCCCGGCCAGGG - Exonic
1135424759 16:22326908-22326930 CCACACTCAAGGCCTGGCACTGG - Intronic
1136232846 16:28897419-28897441 GCCCACTGTAGCCTTGGCTCTGG - Intronic
1136500311 16:30666840-30666862 ATCCACTCCAGGCCTGGCTCTGG - Intronic
1137022189 16:35439912-35439934 GCTGACTCTAGAGCTGGCCCTGG - Intergenic
1137035589 16:35566946-35566968 GCCCACTGTAGGCAGGGCACAGG + Intergenic
1137036053 16:35570917-35570939 GCCCACTGTAGGCAAGGCCCAGG + Intergenic
1137244178 16:46689221-46689243 GCCCTCTCTAGCCCCGCCCCCGG + Intronic
1138201410 16:55091427-55091449 GTCCACTCTAGGCCCTGCCCTGG + Intergenic
1138240443 16:55423405-55423427 TCACACTCAAAGCCTGGCCCAGG - Intronic
1138517063 16:57541954-57541976 GGCAACTCTGGGCCAGGCCCAGG + Intergenic
1138787611 16:59865627-59865649 CCACACTATAGGCCTGGGCCCGG + Intergenic
1139439603 16:66959455-66959477 TCTCACCCTAGTCCTGGCCCTGG + Intergenic
1139911646 16:70400946-70400968 TCCCACTCTAGGCATGGCCTTGG + Intronic
1141443278 16:84042852-84042874 GCCCCCTGCAGGCCCGGCCCCGG + Intergenic
1142212677 16:88815964-88815986 GCCAACTCCAGGCCAGCCCCAGG - Intronic
1143310308 17:5982334-5982356 GTCAACTCCAGCCCTGGCCCAGG + Intronic
1143310447 17:5983587-5983609 GTCAACTCCAGCCCTGGCCCAGG - Intronic
1143474739 17:7196152-7196174 GGGCACTCTGTGCCTGGCCCGGG - Intronic
1143787290 17:9265421-9265443 GCCCACTGGGGGCCTGGCTCAGG + Intronic
1143893440 17:10119354-10119376 GCTCACCGTGGGCCTGGCCCAGG + Intronic
1143908570 17:10228899-10228921 CTCCACCCTAGTCCTGGCCCTGG + Intergenic
1144745210 17:17609370-17609392 CACCACTCCAGGCCTGGCCATGG + Intergenic
1145261691 17:21358394-21358416 GCTCACTGTATGCCAGGCCCTGG + Intergenic
1145264464 17:21373041-21373063 GCCCACCCTAGACCTTGGCCCGG - Intergenic
1146281816 17:31549793-31549815 GCCCGCTCTAGGCGTGGGCTGGG + Intergenic
1147218530 17:38914796-38914818 GCCCAGTACAGGCCTGACCCTGG - Intronic
1147563814 17:41524579-41524601 GACCCCACTGGGCCTGGCCCAGG + Intronic
1148219055 17:45849533-45849555 GTCCACCCCAGGCCTGGCCTTGG - Intergenic
1148244271 17:46020331-46020353 GCTCTGTCTAGGCCTGGCACAGG + Intronic
1148247588 17:46044703-46044725 GCCAACTCTACGCCTGGCTGTGG - Intronic
1148391556 17:47276410-47276432 GCCCTCCCCAGGCCTGCCCCAGG - Intronic
1148810164 17:50285273-50285295 CCCAAATCTTGGCCTGGCCCAGG + Intergenic
1150236022 17:63593240-63593262 GCCCAGCCAGGGCCTGGCCCAGG - Exonic
1150302811 17:64060237-64060259 GACCAAGCTAGGCCTGGACCTGG - Intronic
1150644566 17:66969843-66969865 ACCCACTCCAGGCCTGGTGCTGG + Intronic
1151314408 17:73312541-73312563 GCCCAGTCCAAGCCTGGCCTCGG - Intergenic
1151396591 17:73826992-73827014 GCCCAGCCTGGGGCTGGCCCTGG - Intergenic
1151536559 17:74742155-74742177 ACCCACTCTAGGCCTGGAGAGGG + Intronic
1151903811 17:77034996-77035018 GCCCCCTCCAGGCCCAGCCCTGG + Intergenic
1152008817 17:77698200-77698222 ACCCACTTGAGGCTTGGCCCTGG + Intergenic
1152068134 17:78122547-78122569 GCTCCCTGCAGGCCTGGCCCTGG - Intronic
1152655276 17:81516531-81516553 GCCCACTCCAGACCTGCCCAAGG - Intronic
1152665798 17:81568636-81568658 GGCCCCTCTCGGCCTGGCCTCGG - Intronic
1152708961 17:81860693-81860715 ACTCACACCAGGCCTGGCCCCGG + Exonic
1152738512 17:82008909-82008931 GCCCACTCCCTCCCTGGCCCCGG - Intronic
1152739751 17:82013699-82013721 GCCCTCTGTGGCCCTGGCCCAGG + Intronic
1152970657 18:158448-158470 GCCACCTCTAGGCCCCGCCCCGG + Intronic
1155170919 18:23266329-23266351 GCCTACTGTATGCCAGGCCCTGG - Intronic
1156460953 18:37321039-37321061 GCCCACCCTAGGCACAGCCCTGG - Intronic
1158434665 18:57427776-57427798 GGCCTCTCTAGGCCGGGCGCCGG + Intergenic
1160737810 19:672291-672313 GCCCACTGTGTGCCAGGCCCTGG - Intergenic
1160790896 19:923287-923309 GCCCAAACTAGGGCTGGGCCTGG - Intergenic
1160849155 19:1181764-1181786 TCTCACTCTGGGCCTGGCCCTGG - Intronic
1161063137 19:2225223-2225245 ACCCAGTCCAGGCCTGGCCCAGG + Intronic
1161479551 19:4503674-4503696 GCCCACCACAGGCCTGCCCCAGG - Exonic
1162044757 19:7991205-7991227 CCCCACTCTTGGTCAGGCCCAGG - Intronic
1162431583 19:10631986-10632008 GCCCCCTCTAAGCCTGGCTGAGG + Intronic
1162555593 19:11383859-11383881 GCCCACTCTAGCTCTTGCCCGGG + Intronic
1163018912 19:14472508-14472530 GCCCACCCTGGGCTGGGCCCAGG - Exonic
1163626022 19:18390238-18390260 GCCCACTTTATGCCAGGCCCCGG + Intergenic
1163677004 19:18660298-18660320 CCCCGCTACAGGCCTGGCCCGGG - Intronic
1164181637 19:22824193-22824215 GCCCACTGTGGGCAAGGCCCAGG - Intergenic
1164205416 19:23054481-23054503 GCCCTCTCTAGACAGGGCCCAGG + Intergenic
1164324930 19:24182777-24182799 CCCCACTTTAGGCTGGGCCCAGG + Intergenic
1164704052 19:30305902-30305924 ATCCACTCCATGCCTGGCCCAGG - Intronic
1164731771 19:30510932-30510954 CCCCACTCTACGCCTGACCCGGG - Intronic
1164789186 19:30961539-30961561 TCCTCCTCCAGGCCTGGCCCAGG - Intergenic
1164836542 19:31358495-31358517 GACCACTCAGAGCCTGGCCCAGG + Intergenic
1164865382 19:31600219-31600241 GTCCACTCTAGGCCTCTCCTTGG + Intergenic
1164899831 19:31909070-31909092 GCCCACTGTGTGTCTGGCCCTGG - Intergenic
1164932568 19:32186773-32186795 GGCTACTCCAGGCCTGGGCCAGG + Intergenic
1165330626 19:35139611-35139633 GCCCGCTCGCGGCCTGACCCCGG - Intronic
1165356852 19:35309815-35309837 GCCAACGCGAGGCCCGGCCCCGG - Intronic
1165428924 19:35760772-35760794 GCCCAATTTAGGCCTGGCAGTGG - Intronic
1165487267 19:36103428-36103450 ACCCACCCCAGGCCTGGCTCAGG + Exonic
1165803679 19:38567668-38567690 GCCCGCCCTGTGCCTGGCCCAGG - Intronic
1166406660 19:42526586-42526608 CCACAATCTAGCCCTGGCCCAGG + Intronic
1167293293 19:48635918-48635940 GCAGTCTCCAGGCCTGGCCCAGG + Exonic
1167485584 19:49761260-49761282 GCCTGTTTTAGGCCTGGCCCAGG + Intronic
1168311465 19:55463124-55463146 GCCTACTATGGGCCAGGCCCAGG - Intergenic
925095328 2:1193999-1194021 GCCCACTCTGGGCCTGGGGATGG - Intronic
925967945 2:9083713-9083735 GCCCACACTATCCCTGGTCCAGG - Intergenic
926087246 2:10028195-10028217 GCAGGCTCTAGGCCAGGCCCAGG + Intergenic
926331242 2:11827712-11827734 ACCAATTCTAGGCCAGGCCCTGG - Intergenic
927149789 2:20188973-20188995 CCCATCTCTAGGCCTGGCTCGGG + Intergenic
930771750 2:55136876-55136898 CCCCACTCTGTACCTGGCCCAGG - Intergenic
932115322 2:69041651-69041673 GCCCACTCTAAGCCAGGTGCTGG - Intronic
932290041 2:70569387-70569409 GCCCACTCTGTGCCAGGCCCTGG - Intergenic
932582004 2:72998283-72998305 GTCCACTCTGGCTCTGGCCCAGG + Intronic
933663587 2:84946723-84946745 GCCCACTGCAGGCCGGGCCCTGG - Intergenic
935356812 2:102208978-102209000 GCCTAGTCTAGGCCAGGCACTGG - Intronic
936116977 2:109710508-109710530 GCCAACACTAGGCTTGGCCCAGG - Intergenic
936249944 2:110860533-110860555 GGCCACTCTGAGCCTGGCCTGGG + Intronic
936491859 2:112978895-112978917 GCCTACTCTGTGCTTGGCCCCGG - Intronic
937064978 2:119011082-119011104 TCCCACTCTGGCCCTGGGCCTGG - Intergenic
937223267 2:120353933-120353955 CCCCACTCTAAGCCAGACCCTGG - Intergenic
937839542 2:126511636-126511658 GCCCACTTCAGGCTTGACCCTGG + Intergenic
938159452 2:128972669-128972691 GTCCACTCAAGGCCAGGGCCAGG - Intergenic
938296360 2:130181954-130181976 GCCCAATGTATGCCTGGCACTGG + Exonic
938460389 2:131492684-131492706 GCCCAATGTATGCCTGGCACTGG - Intronic
938947293 2:136224809-136224831 TCCCACATTAGGCCAGGCCCTGG - Intergenic
940043943 2:149389728-149389750 CTCCACTCAAGGCCTGGCTCAGG - Intronic
940326886 2:152434811-152434833 TCCCACCCAAGTCCTGGCCCTGG - Intronic
945995448 2:216432387-216432409 GCCCACTGTAGGCAGGGCACAGG - Intronic
947820257 2:233064147-233064169 GGCCACTCTAGGCCTGATCCCGG - Intronic
1168997328 20:2143205-2143227 GCCCAGTCCAGCCCTGCCCCTGG + Intronic
1170955119 20:20972784-20972806 TGGCTCTCTAGGCCTGGCCCTGG - Intergenic
1171034813 20:21706262-21706284 GCCCACTCCAAGCCAGACCCAGG + Intronic
1171348096 20:24481370-24481392 GCTCACTCGAAGCCTGGACCAGG + Intronic
1172446524 20:34996318-34996340 CCCCATTCTGGCCCTGGCCCTGG + Intronic
1172875024 20:38158859-38158881 CCCAACTCCAGGCCTGGCCTGGG - Intronic
1173080728 20:39864576-39864598 CCTCACCCTAGTCCTGGCCCTGG + Intergenic
1174137898 20:48393164-48393186 GTCTCCTCTAGGCCTGGCCCAGG - Intergenic
1175509571 20:59514790-59514812 GTGCACTCTGGCCCTGGCCCTGG - Intergenic
1176284475 21:5012293-5012315 CCCCACTCTAGGCCTGCCTGGGG + Intergenic
1179494704 21:41764254-41764276 GCCGGCTGAAGGCCTGGCCCAGG + Intronic
1179600806 21:42476197-42476219 GCCCAGCCTAGGCCTGGCCAGGG + Intronic
1179810382 21:43865693-43865715 GCCCTCCCTCGGCCCGGCCCGGG - Intronic
1179872706 21:44251182-44251204 CCCCACTCTAGGCCTGCCTGGGG - Intronic
1179930753 21:44569444-44569466 TCCCACTCTGTGCCTGGGCCAGG - Intronic
1179978326 21:44883418-44883440 GCGCATTCTTGGCTTGGCCCTGG - Intergenic
1180188873 21:46153407-46153429 GCCCCCTCTTGGCCTGGCCGGGG - Intronic
1180757546 22:18173058-18173080 GCCCACACTAGGCCCGACTCTGG - Intronic
1182359704 22:29739398-29739420 GCTCACTCGGGGCCGGGCCCTGG + Intronic
1182427090 22:30279604-30279626 GGGCACGCGAGGCCTGGCCCTGG - Intergenic
1182903995 22:33920880-33920902 GCCCACTCCTGGCCGGGCGCGGG - Intronic
1183178933 22:36245462-36245484 TCTCACCCTAGTCCTGGCCCTGG - Intergenic
1183374468 22:37454899-37454921 GCCCACTCCAGGTCTGGCAGAGG - Intergenic
1184032523 22:41903356-41903378 GCCTGCTGTATGCCTGGCCCTGG + Intronic
1184109352 22:42385743-42385765 GCCCACCCTGTGCCAGGCCCTGG - Intronic
1184533368 22:45070781-45070803 GCCTCCTCTAGTGCTGGCCCAGG - Intergenic
1184768348 22:46584187-46584209 GCTGACTCTAGGCCTGGGCAGGG - Intronic
1184880762 22:47302995-47303017 GCCCACTCTAAGCCAGGGACTGG + Intergenic
1185080314 22:48706065-48706087 GGCCACTCTTGCCCTGGGCCTGG + Intronic
1185108819 22:48889517-48889539 GCCCACTCCATGCATGGACCTGG - Intergenic
1185142980 22:49113535-49113557 GCTCACACTAGGGCTGGCACTGG + Intergenic
950103524 3:10373978-10374000 GCCCTCTCTGAGCCTGGACCTGG - Intronic
950534289 3:13570388-13570410 GCTTGCTCTGGGCCTGGCCCTGG + Exonic
951585351 3:24209662-24209684 GCCCACCCTATGACAGGCCCTGG - Intronic
951660111 3:25053979-25054001 TCCTACTCTGGGCCTGGCGCAGG + Intergenic
953024049 3:39134683-39134705 ACCTCCTCTAGGGCTGGCCCAGG + Intronic
953149133 3:40308928-40308950 CCCCACTCGATGCCAGGCCCAGG + Intergenic
953931784 3:47009349-47009371 GCCCCCGGCAGGCCTGGCCCGGG + Exonic
954380151 3:50215033-50215055 GCCCACACAAGGCCTGGCCGTGG - Intronic
954748960 3:52803053-52803075 GCCCACACTGGGCATGGCCCAGG + Intronic
955660997 3:61298940-61298962 CCTCACCCTAGCCCTGGCCCTGG - Intergenic
957227454 3:77468312-77468334 GCAGACTCTAGGCCTGTCTCTGG - Intronic
959628970 3:108486515-108486537 TCCCACTCTAGACCTGCTCCTGG - Exonic
959808261 3:110585083-110585105 GCTTACTCTATGCCTGGCACTGG - Intergenic
960140062 3:114142961-114142983 GCCCCCAGCAGGCCTGGCCCTGG + Intronic
960224895 3:115157739-115157761 GGGGACTCTGGGCCTGGCCCAGG - Intergenic
961058713 3:123810544-123810566 GCCAGCTCTAAGCCTGGCCCTGG + Intronic
961469239 3:127101011-127101033 CCCCCCTCTAGAGCTGGCCCTGG - Intergenic
962370085 3:134814019-134814041 GCCTACTCTGTGCCAGGCCCCGG - Intronic
962493540 3:135917370-135917392 GCTCACCATAGTCCTGGCCCTGG + Intergenic
963255334 3:143139276-143139298 GACCACTCTACGCCAGACCCAGG - Intergenic
964474244 3:157084326-157084348 CCCCACTCTAGGGGTTGCCCAGG - Intergenic
964500014 3:157339051-157339073 CTCCACTCTAGTTCTGGCCCTGG + Intronic
966933050 3:184688031-184688053 GCCTACTATAGGCCAGGCACTGG + Intergenic
967856975 3:194125453-194125475 GCCGAGTCTAGGTCTGCCCCAGG + Intergenic
968501439 4:951974-951996 GCCCATCCCAGGCCTGTCCCTGG + Intronic
968503357 4:961183-961205 GCCCACCCTGGACCTGGCCCTGG + Exonic
968503401 4:961302-961324 GCCCACCCTGGACCTGGCCCTGG + Intronic
968503427 4:961364-961386 GCCCACCCTGGACCTGGCCCTGG + Intronic
968509117 4:987583-987605 GCCAACGCCAGCCCTGGCCCTGG - Intronic
968866046 4:3212589-3212611 GCCCACTCTGGCCCGGGCCCTGG + Exonic
969527305 4:7710378-7710400 ACCCACTGCAGGCCGGGCCCAGG - Intronic
973888547 4:55346696-55346718 GCGCTCCCTCGGCCTGGCCCCGG + Intronic
975627294 4:76362759-76362781 CCTCACCCTAGTCCTGGCCCTGG + Intronic
977014641 4:91677787-91677809 GGGCACCCTGGGCCTGGCCCAGG - Intergenic
977923144 4:102668325-102668347 GCCGACTCCAGGTCTGGCACAGG - Intronic
978034451 4:103976395-103976417 GGGGACTCTGGGCCTGGCCCAGG - Intergenic
985481076 5:111305-111327 GGCCACTCAGGGCCTGGGCCAGG - Intergenic
985927015 5:3026752-3026774 TCCCACTCTATGCATGGCCAGGG + Intergenic
986209705 5:5659318-5659340 GACCACTTCAGGCTTGGCCCTGG + Intergenic
987940717 5:24532028-24532050 GCCCTCCCTAGCCATGGCCCTGG - Intronic
989609076 5:43274177-43274199 CCACACTCTAGACCTGGCTCTGG + Intronic
992445693 5:76831405-76831427 TCCCACTCTAGCCCTGAGCCAGG - Intronic
994060978 5:95476122-95476144 CCCCACTCTTGTCCTTGCCCAGG + Intronic
995780199 5:115767317-115767339 ACCCAAGCTAGGCCTGGCCTAGG + Intergenic
996309334 5:122085801-122085823 GCCCACTCTACCCCTGCCCCAGG + Intergenic
997415022 5:133720996-133721018 GCCCACTCTTTGCCTGCCACTGG + Intergenic
997474346 5:134133995-134134017 GGCCATGCTGGGCCTGGCCCAGG - Intronic
997475663 5:134140943-134140965 GCCCACACAAGGCCATGCCCAGG + Intronic
997639600 5:135440004-135440026 GCCAAGTCCAGGCCTGGCACAGG + Intergenic
997699302 5:135885266-135885288 GCCCATTGTATGCCTGGCACTGG - Intronic
997791320 5:136765021-136765043 GCCAACTCTGGGCCAGGCTCTGG + Intergenic
997835364 5:137187669-137187691 GCTCACTCTAGGCATGCTCCTGG + Intronic
998208160 5:140174505-140174527 GCTCATTCTAGGCCTTGCTCTGG + Intergenic
999461174 5:151758646-151758668 GCGCACTAGAGGCCTGGTCCCGG + Exonic
1001104286 5:168839912-168839934 GTTCACCCTAGGCCTGGCCCTGG - Intronic
1001549625 5:172593627-172593649 GCCCACTTTGGACCAGGCCCTGG + Intergenic
1001600715 5:172926446-172926468 TCCACCTCCAGGCCTGGCCCTGG - Intronic
1002058746 5:176613675-176613697 GCCCACCCTAGAGCTGGCACTGG - Intergenic
1002106143 5:176880235-176880257 GCACACACTGGGCCTGGGCCAGG + Exonic
1002160606 5:177312079-177312101 GCTGGCTCCAGGCCTGGCCCTGG + Exonic
1003171502 6:3724933-3724955 CCACACTCCAGGCCTGGCCATGG - Intronic
1003226263 6:4208588-4208610 GCCTACTCTATGCCAGGCACTGG - Intergenic
1004793176 6:19051302-19051324 CCCCACTCCTGCCCTGGCCCAGG - Intergenic
1005049097 6:21667002-21667024 CCCCACCCTAGCCCTGACCCTGG + Intergenic
1005379566 6:25219122-25219144 GGCCACACTAGGCATGGCCCAGG + Intergenic
1006056640 6:31390075-31390097 TCTCATTCTTGGCCTGGCCCAGG + Intergenic
1006069364 6:31486990-31487012 TCTCATTCTTGGCCTGGCCCAGG + Intergenic
1006185873 6:32181433-32181455 GGGAACTCTAGCCCTGGCCCTGG - Exonic
1009373949 6:62944262-62944284 GACATCTCTAGGGCTGGCCCTGG + Intergenic
1012413215 6:98983851-98983873 GCCCATTTCAGGGCTGGCCCTGG - Intergenic
1013053830 6:106563814-106563836 CTCCAAGCTAGGCCTGGCCCTGG + Exonic
1016987412 6:149905603-149905625 GCCCACTCGTGGCCTGCTCCAGG - Intergenic
1017725483 6:157273812-157273834 GCCCACCCGAGGCCTGGCCAGGG - Intergenic
1019577069 7:1742677-1742699 GGCCACTCCAGGCCAAGCCCTGG + Intronic
1019708627 7:2508273-2508295 GCCCGAGCGAGGCCTGGCCCTGG + Intergenic
1019934881 7:4247709-4247731 ACTCACTGTGGGCCTGGCCCAGG + Intronic
1023854726 7:44175796-44175818 GCCCACGATGGGCCAGGCCCTGG - Intronic
1025744094 7:64227691-64227713 GCCCACTGTAGGCAGGGCACAGG + Intronic
1025744357 7:64230006-64230028 TCCCACTGTCGGCATGGCCCAGG + Intronic
1025751588 7:64298544-64298566 TCCCACTGTTGGCATGGCCCAGG + Intergenic
1029273039 7:99388300-99388322 GGACACTCTAGTCCTGCCCCCGG - Intronic
1031974777 7:128086705-128086727 GCTCACTCTGGGCCTGGTGCTGG - Intronic
1032095819 7:128938134-128938156 GCCCAGTCTAGGCCTAGACTTGG - Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1035073250 7:156159985-156160007 GCCCACCCTGGTCCTGGCCTCGG + Intergenic
1036643316 8:10597462-10597484 GCCAGCTCAAGGCCTGTCCCTGG - Intergenic
1037827532 8:22168250-22168272 GCCCTCACTAGCCCTTGCCCAGG + Intronic
1038644829 8:29352559-29352581 GCTCACCCTAGTCCAGGCCCTGG + Intergenic
1039049028 8:33476168-33476190 GGCCACTTAAGGCCTGGACCCGG - Intronic
1040278517 8:46025981-46026003 GACCACTCCAGGCCTGGCGCAGG + Intergenic
1040534776 8:48299255-48299277 ACTTACTCTGGGCCTGGCCCTGG - Intergenic
1042128315 8:65560727-65560749 GCCCGCTCTAGGCTTGCACCAGG - Intergenic
1042811869 8:72834582-72834604 GCCTGCTCTAGGCCTGGCTCAGG - Intronic
1043002137 8:74772014-74772036 GCCCTCTCTGGGGCTGGCCGAGG - Intronic
1045387983 8:101689653-101689675 GCCCACTGTGTGCCCGGCCCTGG + Intronic
1046616633 8:116484826-116484848 CCCTGCTCTAGGCCAGGCCCAGG + Intergenic
1047248950 8:123167185-123167207 GCCCACTCTGGGCCAGTCCATGG - Intergenic
1049171899 8:141166803-141166825 GCTCACTTTAGCCCTGGCCCTGG - Intronic
1049475111 8:142793718-142793740 GCCCACCCCAGGCCCTGCCCAGG - Intergenic
1049644140 8:143728531-143728553 GCCCACGAGAGGCCCGGCCCCGG + Exonic
1049686119 8:143939965-143939987 GCTCCCTCCAGGCCTGGGCCAGG + Intronic
1049808226 8:144551105-144551127 TCCTTCCCTAGGCCTGGCCCAGG - Intronic
1050505272 9:6341837-6341859 GCCCACCCTACGACAGGCCCCGG - Intergenic
1051292184 9:15555837-15555859 CCCCACTCTCTGCCAGGCCCCGG + Intronic
1051934765 9:22433811-22433833 CCCCTCTCTGGGGCTGGCCCAGG + Intergenic
1053131569 9:35618507-35618529 GGCCCCTCTGGCCCTGGCCCAGG - Intronic
1055355944 9:75437035-75437057 GCCCTCTCCAGGCTTGACCCAGG + Intergenic
1055610667 9:78020878-78020900 GCCCACTTTACTCCTGGCCCAGG - Intronic
1060260658 9:122071119-122071141 GTCCACTCTAAGCCAGGCACTGG - Intronic
1060727621 9:126016652-126016674 GGCCCTGCTAGGCCTGGCCCTGG + Intergenic
1062005244 9:134235566-134235588 GCCGAGTCTGCGCCTGGCCCTGG + Intergenic
1062039995 9:134400192-134400214 GCCCATGAGAGGCCTGGCCCAGG + Intronic
1062208410 9:135349751-135349773 GCCCACTCCAGGCTGAGCCCTGG - Intergenic
1062245034 9:135561816-135561838 GCTCACCCTGGGCGTGGCCCTGG + Exonic
1062314395 9:135959254-135959276 TGCCACTCTAAGCCCGGCCCTGG + Intronic
1062466997 9:136685953-136685975 GCACACTCCAGGGCTGGCCCAGG - Intronic
1185483122 X:463107-463129 GCCATCTCCAGCCCTGGCCCTGG + Intergenic
1186107828 X:6226423-6226445 GCACCCCCGAGGCCTGGCCCGGG - Intronic
1192247787 X:69387893-69387915 GCCCCCTCTGGGCCTGTCTCCGG + Intergenic
1192314934 X:70044033-70044055 TCCCACTGTGGGCCTGCCCCAGG + Intronic
1192533348 X:71908498-71908520 ACCCACTCTAGTCCTGGCAAGGG + Intergenic
1193312317 X:80023599-80023621 GCGCCCGCTAGACCTGGCCCAGG + Intronic
1194970300 X:100335744-100335766 GCCCACTATGTGCCTGGCTCTGG - Intronic
1195975833 X:110525444-110525466 GCTCACTCTAATCCTGGCCCTGG + Intergenic
1196828036 X:119756427-119756449 GCCCATTCTGGGCCTAGGCCTGG + Intergenic
1198727853 X:139695831-139695853 GCCCACTATATGCCAAGCCCTGG - Intronic
1199641689 X:149868474-149868496 GCCCACACTGTGCCTGTCCCTGG - Intergenic
1199688841 X:150290829-150290851 ACCCACTCCAGGCTTTGCCCAGG + Intergenic
1199854897 X:151752132-151752154 GCCCTCTCTAAGCGTGGCCTTGG - Intergenic
1200256128 X:154584427-154584449 CCGGGCTCTAGGCCTGGCCCAGG - Intergenic
1200261641 X:154619976-154619998 CCGGGCTCTAGGCCTGGCCCAGG + Intergenic
1200267623 X:154654273-154654295 CCGGGCTCTAGGCCTGGCCCAGG + Intergenic
1200869678 Y:8084055-8084077 GCCCTCTCTAGGCAGGGCCTAGG + Intergenic