ID: 1088641813

View in Genome Browser
Species Human (GRCh38)
Location 11:111879935-111879957
Sequence CAATATATGCAAAAGCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088641813 Original CRISPR CAATATATGCAAAAGCTTGA TGG Intronic
900468249 1:2836244-2836266 AAAGAGATGCAAAAGCTTCAAGG - Intergenic
901127005 1:6936656-6936678 CAATACATCAAAAAGCTTGGTGG - Intronic
901303207 1:8214713-8214735 CATTGTCTGCAAAAGCCTGATGG + Intergenic
904179943 1:28659080-28659102 CAAAAAATGCAAAAGCTAGCTGG + Intergenic
905069643 1:35214050-35214072 CAAACTATGCAAATGCTAGAAGG + Intergenic
905879324 1:41453395-41453417 CAACAGATGCAAAAGCATGGAGG - Intergenic
907036163 1:51218280-51218302 CAAAATATACAAAAGCTAGCTGG - Intergenic
908071363 1:60463968-60463990 CAGTATATGCAAAGGCATTAAGG + Intergenic
908577670 1:65478125-65478147 AAATATGTGCAAGAGCTTGAAGG + Intronic
908909164 1:69052736-69052758 CAATATAATCAAAAGCTTAAGGG - Intergenic
909770037 1:79410516-79410538 CAAGATATTCAATATCTTGAAGG - Intergenic
911041591 1:93595233-93595255 TAAAATATGCAAGAGCTTAAAGG - Intronic
911978341 1:104533115-104533137 AAATATATGCATTAGCTTGGTGG - Intergenic
912437254 1:109670437-109670459 CAGTATAGGAAATAGCTTGAAGG - Intronic
913360687 1:117976981-117977003 GAATGTGTTCAAAAGCTTGAAGG - Intronic
914725684 1:150325415-150325437 AAATACATGAAAAAGCTTGAAGG + Intronic
915784281 1:158591250-158591272 AAATATATGGATAAGTTTGAGGG + Intergenic
917594238 1:176512418-176512440 TAACATATGCAACAGCTTTAAGG + Intronic
917597370 1:176542919-176542941 CAATATATTTAAAATCTTGTAGG + Intronic
919448478 1:197740213-197740235 CAAAAAATGCAAACCCTTGAAGG + Intronic
919538525 1:198819370-198819392 CAATAAATGTTAAAGCATGAAGG - Intergenic
920683642 1:208092539-208092561 CTATGCATTCAAAAGCTTGAAGG - Intronic
921349653 1:214222555-214222577 CTGTAAATGCAAAAGCTGGAAGG + Intergenic
923664567 1:235988594-235988616 CATTATTTGCAAAAGCCAGAAGG + Intronic
923668909 1:236023182-236023204 CATTATTTGCAATAGCTGGAAGG + Intronic
924173475 1:241365521-241365543 GAATAAAGGCAAAGGCTTGATGG + Intergenic
924834511 1:247635446-247635468 AAATTTAGGCAAAAGCTTAAAGG + Intergenic
1064042548 10:11980774-11980796 TAATATATGAAAATGTTTGATGG + Intronic
1065977292 10:30853580-30853602 CCATTTGTGCAAAACCTTGAAGG - Intronic
1066701994 10:38139741-38139763 CAATATTTTCAGAGGCTTGAAGG - Intergenic
1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG + Intronic
1068245888 10:54367248-54367270 CAGATTATGGAAAAGCTTGAAGG + Intronic
1068689765 10:59903939-59903961 CAAAACCTGCAAAATCTTGAAGG + Intronic
1069589795 10:69634658-69634680 CAATATATAAAATACCTTGAGGG + Intergenic
1071074483 10:81734355-81734377 CAACATAAGCAAATGCTTAAGGG - Intergenic
1071125502 10:82330054-82330076 CCATATATGGAAAATCTTTATGG - Intronic
1071195237 10:83151435-83151457 CAATATATGTAAAAGTTAAAAGG - Intergenic
1073034049 10:100550775-100550797 CTATAGATGCAAAAGCATGCCGG - Exonic
1074451098 10:113560238-113560260 CAATGTGTGCAAAAGCCAGAAGG + Intronic
1075110434 10:119576282-119576304 AGATATATTCAAAAGTTTGATGG - Intronic
1077599477 11:3564030-3564052 CTATGTTTGCAAAAGCTTGCAGG - Intergenic
1079652789 11:22950801-22950823 CAATGTATGAAAAAGCATGAGGG - Intergenic
1079674909 11:23214836-23214858 GAATATATGCATAAACATGAGGG - Intergenic
1080231456 11:30020929-30020951 CTATATAAGCAAAGGCTTCACGG - Intergenic
1080339100 11:31237292-31237314 CAATATATACTCAAGCTAGATGG + Intronic
1080345892 11:31324506-31324528 AAATATTTGTAAAGGCTTGAAGG + Intronic
1085705615 11:78784629-78784651 CAATATAAGAATAAGGTTGACGG - Intronic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1086331913 11:85762636-85762658 CAGCACATGCAAAAGCCTGAAGG - Intronic
1087253498 11:95929848-95929870 CAAAATATACAAAAGCTAGGTGG + Intergenic
1087417880 11:97881707-97881729 CAAATTATGCAAAAAGTTGATGG + Intergenic
1088531733 11:110817961-110817983 CAGTATATGCAAAAGCATGAAGG + Intergenic
1088641813 11:111879935-111879957 CAATATATGCAAAAGCTTGATGG + Intronic
1088766251 11:112982337-112982359 CAATGTATGCAAAGGTTTGGTGG + Intronic
1089143006 11:116302624-116302646 CAACATAAGCAAAAGCGTGGAGG + Intergenic
1089692024 11:120192965-120192987 GAATTGATGCCAAAGCTTGACGG + Intergenic
1090553935 11:127853371-127853393 GAAAATAGGCAAAAGCATGAAGG - Intergenic
1091764245 12:3107879-3107901 GAATATGTGCAAAGGCTTGGGGG - Intronic
1093501181 12:19814384-19814406 TAATATATGTAAAAGATTGAGGG - Intergenic
1095109253 12:38273757-38273779 GAATATATGAAATAGCTTCAAGG + Intergenic
1095361526 12:41346654-41346676 CAATCTAACCAAAAGCTTGATGG + Intronic
1095473043 12:42556744-42556766 CAATATATGTACATGCCTGATGG + Intronic
1095610046 12:44117206-44117228 CAATATATGCAAAAGTAAGGAGG - Intronic
1097856271 12:64466212-64466234 CAAAATATGTAAAAGGTTTAGGG - Intronic
1098094195 12:66937073-66937095 TCATATTAGCAAAAGCTTGAAGG + Intergenic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098463446 12:70759731-70759753 CAACACATACAAAAGCATGAAGG + Intronic
1099127539 12:78782622-78782644 CAATATCTGGAAAAACTTTAGGG + Intergenic
1103688904 12:122754183-122754205 CTATGTAAGAAAAAGCTTGATGG + Intronic
1104240233 12:126981401-126981423 CAATAAAGACAAAAACTTGAAGG - Intergenic
1105229653 13:18480060-18480082 CAATATTTACAAAAGCCAGAAGG + Intergenic
1106633264 13:31499590-31499612 GAGTATATGAAAATGCTTGATGG - Intergenic
1106703272 13:32252452-32252474 CCATTCATTCAAAAGCTTGATGG - Intronic
1107172674 13:37361605-37361627 CAATATAAGCAAAAGGATAAAGG + Intergenic
1107202068 13:37733407-37733429 CATCATCTCCAAAAGCTTGATGG - Intronic
1109523107 13:63537901-63537923 CAAGATATGCAAAAGCTGAGGGG + Intergenic
1109880144 13:68461711-68461733 AGATAAAAGCAAAAGCTTGAAGG - Intergenic
1111835731 13:93386302-93386324 CATTATTTTAAAAAGCTTGAAGG - Intronic
1115231730 14:31167696-31167718 CAGTATGTGCAAATGCATGAAGG - Intronic
1115871832 14:37813282-37813304 TAATATATCAAAAAGCTTAAAGG - Intronic
1116042948 14:39707823-39707845 CAATACATGTAAAAGATTCACGG - Intergenic
1117186725 14:53247291-53247313 CAGTATATGCAAAAGCACGGAGG + Intergenic
1119633634 14:76256464-76256486 TAATATATGCAAATACTTGTTGG + Intergenic
1120160960 14:81143786-81143808 CAATATATGCCAGAGCAAGAGGG - Exonic
1120571755 14:86127005-86127027 CAATATATTCAATAGATTAAAGG - Intergenic
1124163075 15:27292322-27292344 TAATATAGGCAACAGGTTGATGG + Intronic
1124175430 15:27419310-27419332 CAAAATATCAAAAAGCCTGAGGG - Intronic
1126860028 15:52874348-52874370 CAATATATGGAAATGCATAAGGG - Intergenic
1127357476 15:58214404-58214426 CATTATAAGCAACAGCTAGATGG + Intronic
1129936735 15:79457146-79457168 CAAAATATGTAGAGGCTTGAAGG - Exonic
1130584424 15:85169379-85169401 CAATAGATGCTAAAGCTAGTGGG + Intergenic
1130744916 15:86641154-86641176 CATCATATACAAAATCTTGAAGG - Intronic
1131619016 15:94047309-94047331 AAATATATGAAAAAGCATGAGGG + Intergenic
1131811397 15:96177560-96177582 AAATAGCTGCAAAAGCTTCAGGG + Intergenic
1132439700 15:101848089-101848111 CAATATACCCAAATGCTTGTTGG - Intergenic
1133873519 16:9711604-9711626 CGATATATGCTGAATCTTGAAGG - Intergenic
1135340196 16:21638778-21638800 CAGCATGTGCAAAAGCATGAAGG + Intronic
1135498477 16:22973311-22973333 GAATATATGCAAAGACTTGGAGG + Intergenic
1137959505 16:52867893-52867915 CATTATATCAAAAAGCTTGTAGG - Intergenic
1138611005 16:58124033-58124055 CAGGAAGTGCAAAAGCTTGAAGG + Intronic
1139181086 16:64749631-64749653 CAACATATGGTAAAGCTTTAGGG - Intergenic
1143209398 17:5172880-5172902 CAATTTCTGCCAAAGATTGATGG + Exonic
1143222608 17:5275237-5275259 CAATATTTGCAAAAGCCTAACGG - Intergenic
1144618879 17:16802334-16802356 CAATTTCTGCCAAAGATTGATGG + Intronic
1144890102 17:18489559-18489581 CAGCATATGCAAAAGCATGGTGG - Intronic
1144893827 17:18513361-18513383 CAATTTCTGCCAAAGATTGATGG - Intergenic
1145138401 17:20430913-20430935 CAATTTCTGCCAAAGATTGATGG + Intergenic
1145142114 17:20454758-20454780 CAGCATATGCAAAAGCATGGTGG + Intronic
1145793794 17:27644143-27644165 CAGCATATGCAAAAGCATGGTGG - Intronic
1153096792 18:1416059-1416081 CAAAATAGGCAAAAGCCTTAAGG - Intergenic
1153501467 18:5754378-5754400 AAATATTTGTAAAAGCTTAATGG - Intergenic
1153834283 18:8950212-8950234 GCATATATGCACAAGCTTCAGGG + Intergenic
1156178828 18:34579577-34579599 CAATATCTGCAAAGTATTGAAGG - Intronic
1156616531 18:38792406-38792428 CAATAGATAGCAAAGCTTGAGGG - Intergenic
1157347259 18:46850718-46850740 CAATGGATGCCGAAGCTTGACGG - Intronic
1158049212 18:53194947-53194969 CAATATTTGAAAAAGCTTCAGGG + Intronic
1158265611 18:55657856-55657878 CAGTTTATGCAAAAGCAGGAGGG + Intronic
1159332609 18:67017735-67017757 CAATTTATAGAAAAGGTTGATGG + Intergenic
1159492317 18:69153233-69153255 AATTATATCTAAAAGCTTGAGGG - Intergenic
1160137921 18:76288962-76288984 AAATATGTTCAAAAACTTGAAGG + Intergenic
1160253181 18:77221918-77221940 CAGTCTATGCAAAATCTGGAAGG + Intergenic
1160390878 18:78531505-78531527 AAATATATACAAATGCTTGAGGG - Intergenic
1162548995 19:11348117-11348139 CAGCATGTGCAAAAGCTTGGAGG - Intronic
1164952535 19:32349400-32349422 CAAGGTAAGCAAAAGCTTCATGG - Intronic
1167035125 19:46990681-46990703 CAATTTATTCACAAGCCTGATGG + Intronic
1168610621 19:57796597-57796619 CAATAGGTGCAAAGGCTTGGAGG - Intronic
928119000 2:28568261-28568283 CAATGTATGCAATAGCTTTCTGG + Intronic
928560324 2:32477031-32477053 CATAATTTGTAAAAGCTTGAAGG - Intronic
928688201 2:33772038-33772060 CAATATATGCAAAGTTCTGAGGG - Intergenic
930146417 2:48010546-48010568 CCATATATACAAAAGCTTTCTGG + Intergenic
930575040 2:53136298-53136320 CAGCATAAGCAAAAGCTTGGAGG + Intergenic
930925236 2:56810187-56810209 CAACATTTTCAAAACCTTGAAGG + Intergenic
933767546 2:85720383-85720405 CAACACATGCAAAAGCTTAATGG + Intergenic
935054005 2:99549648-99549670 TAATATTTCCAAATGCTTGAAGG + Intronic
935220425 2:101007641-101007663 CAATACATAGAAATGCTTGAGGG + Exonic
936602010 2:113905923-113905945 CAATATCTGCAATAGCTAAAAGG - Intronic
937649885 2:124307931-124307953 CAATATATGACAAAGCTGGCGGG + Intronic
938915379 2:135933693-135933715 CAATAAAAACAAAAGCTTGTAGG + Intronic
939146557 2:138422679-138422701 CAAGATATGCAATTGCCTGAAGG - Intergenic
940749996 2:157615082-157615104 CAATTAATCCAAAAGCATGAGGG - Intronic
942081349 2:172402273-172402295 CAGTAAATGCAAATGCTTGGTGG - Intergenic
943146570 2:184053690-184053712 TAATATATTCAAAACCTTCATGG - Intergenic
944396753 2:199276705-199276727 CAATTTATGAAAAAGCTGGCAGG + Intronic
944624487 2:201557375-201557397 CAATATATAAAATAGCTTGGAGG - Intronic
944706041 2:202289458-202289480 CCTTATATACAAAACCTTGAAGG - Intronic
945581541 2:211601649-211601671 AAATATTTGCAAAATATTGAGGG + Intronic
945600346 2:211855161-211855183 AAAAATGTGCAAAATCTTGAAGG - Intronic
945800189 2:214419541-214419563 CAAGCTATGCAAAAGCTGAAAGG - Intronic
947773109 2:232686587-232686609 CCACATATGCAAAAGCCTGGAGG - Intergenic
1168807753 20:682664-682686 CAATATATGCAAAGGCTTTGAGG - Intergenic
1169566431 20:6858242-6858264 CAACATATTAAAATGCTTGAAGG + Intergenic
1169852403 20:10066572-10066594 CAGTTTATGCAAAAACTTAATGG - Intergenic
1170756404 20:19210809-19210831 CTGTGTCTGCAAAAGCTTGATGG + Intergenic
1171286553 20:23943987-23944009 CATTATGTGCAAAAGCAAGAGGG - Intergenic
1173791447 20:45830387-45830409 CAGCATGTGCAAAGGCTTGAAGG - Intronic
1174491256 20:50897797-50897819 GACAATAAGCAAAAGCTTGAAGG + Intronic
1175114684 20:56673803-56673825 CAGTATATGCAAAGGTATGATGG + Intergenic
1176702440 21:10071837-10071859 CAATAAATGAAAAAGTATGATGG - Intergenic
1179102907 21:38371111-38371133 AAAGATATGCAAGAGCTTTATGG - Intergenic
1181835458 22:25603805-25603827 AAATATGTGCAAGAACTTGATGG - Intronic
1182908585 22:33959915-33959937 CAAGCTATGCAAAAGCATGAAGG - Intergenic
1184199305 22:42954981-42955003 CAATATATGCAAAGGCAAGGAGG - Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950633056 3:14296870-14296892 CAAAATATGAAAAAACTTCATGG + Intergenic
951246683 3:20349575-20349597 CAATACATGCAGAAGCTGGATGG + Intergenic
952053507 3:29415343-29415365 CAATAAATGGAATAGCTTGCAGG + Intronic
952417940 3:33106471-33106493 CAACATATGCAAAGGCTTATGGG - Intergenic
957070295 3:75562663-75562685 CTATATTTGCAAAAGCTTGCAGG - Intergenic
957437124 3:80192490-80192512 CAATATATTCAAAATTTTCAAGG - Intergenic
957660489 3:83145333-83145355 CACTATATGAAAGGGCTTGAGGG - Intergenic
958120224 3:89277331-89277353 AAATATATTCAAGAGCTTAAAGG - Intronic
959421451 3:106134840-106134862 TAATATATGAAAAAGCCTGAGGG - Intergenic
960108913 3:113826669-113826691 CAATATTAGAAAGAGCTTGAAGG - Intergenic
962113275 3:132472760-132472782 CAATAAATGCAAAAGATTACAGG - Intronic
962546859 3:136445229-136445251 TAATATAGGCAAAGGTTTGAGGG + Intronic
963719704 3:148848087-148848109 CAATATAAGAAAAAGTTGGAAGG - Intronic
963910049 3:150809017-150809039 TAATATATGCAAATCCTTGCTGG - Intergenic
964677586 3:159300874-159300896 CAAAATCTGCAAAAACTTTAAGG - Intronic
965342508 3:167507535-167507557 AAACATGTGCAAAAGATTGAGGG + Intronic
965751417 3:171978548-171978570 CAAGAAATGCAAAGGCTCGATGG - Intergenic
966830191 3:184001546-184001568 CAATATCTGGAAATGTTTGAGGG + Intronic
967863241 3:194169327-194169349 CAATATTTCAAAAAGCTTCATGG - Intergenic
971295966 4:25392035-25392057 AAATATATGTAAAAACTTAAAGG - Intronic
971300914 4:25441800-25441822 CAGTGTGTGCAAAAGCTTGGAGG + Intergenic
972737306 4:41855349-41855371 CAATATCTCCAAAAACTGGAGGG + Intergenic
973188621 4:47361359-47361381 CAACATATGCAAAAGCTTTGTGG + Intronic
974363571 4:60915868-60915890 CAATATATGCAAATACCTTAAGG + Intergenic
975688294 4:76939747-76939769 AAATCTAAGCAAAAGTTTGATGG + Intergenic
976916968 4:90388124-90388146 CATTTTATGGAAAAGCATGAAGG + Intronic
976919948 4:90426509-90426531 CAATATAGGGAAAAGACTGAAGG + Intronic
977786749 4:101044027-101044049 GATTATATGGAAAAGATTGAAGG - Intronic
978843981 4:113250064-113250086 AAATATAGACAAAAACTTGAAGG - Intronic
980068872 4:128221162-128221184 CAATATATGCTAAATCTTTTGGG + Intronic
980302773 4:131015046-131015068 CAAAATATGCAAATGGTGGAGGG + Intergenic
980374613 4:131928253-131928275 CAATAAATGAAAAAGTATGATGG - Intergenic
984080591 4:175245154-175245176 CAGGATGTGCAAAAGCATGACGG + Intergenic
984119542 4:175725026-175725048 CAATTTGAGCAAAATCTTGAAGG - Intronic
984876069 4:184368832-184368854 AAATTTAAGCAAAAACTTGAAGG + Intergenic
985348816 4:189035969-189035991 CAATTTATTGAAAAGCTTCACGG - Intergenic
987872382 5:23637657-23637679 AAACATATGCAAAATCCTGAAGG + Intergenic
988644137 5:33075285-33075307 CATTATATCCAAAAACTTGAAGG + Intergenic
990433363 5:55760592-55760614 GAATATTTGTAAAAGCTTCAGGG + Intronic
990621429 5:57563703-57563725 CAACATATGCAACAACTTGTAGG + Intergenic
991577534 5:68120884-68120906 AAATATATACAAAAGATTAAAGG + Intergenic
993501344 5:88671306-88671328 CAAAATATGCAGAATCTGGAGGG + Intergenic
994866166 5:105273626-105273648 TAATAAATGTTAAAGCTTGAGGG - Intergenic
996228682 5:121033655-121033677 CAATATTTTTAAAAGCTTTAAGG + Intergenic
996671336 5:126121550-126121572 CAATATGTGTAAAAGCTTTTAGG + Intergenic
998609661 5:143674315-143674337 CAGCATATGCAAAGGCTTGGAGG - Intergenic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
1000531502 5:162427126-162427148 CAATACATGCAAAACCAAGATGG - Intergenic
1001947281 5:175790419-175790441 CAAATTATGCAAAACCTTGAAGG + Intergenic
1005275684 6:24215227-24215249 CAGCATATGCAAAGGCTTGGAGG + Intronic
1006522303 6:34578157-34578179 CAATATTTGAAAATGCTTGGCGG + Intergenic
1009864045 6:69374419-69374441 CATTATATGATAAAGCTTGCAGG - Intronic
1011736560 6:90316341-90316363 CATTATATTCAAAAACTAGAAGG + Intergenic
1011958953 6:93062215-93062237 CAATATATGTATAGGCATGAAGG - Intergenic
1012504366 6:99928136-99928158 CAATATATGCAAATCCATAAAGG - Intronic
1012961249 6:105624350-105624372 CAATTTATGCAAAAACTTTCAGG + Intergenic
1013206192 6:107948043-107948065 AAGTATATGCAAAAGCATGGAGG - Intronic
1014776348 6:125514534-125514556 TGATATATGCAACAACTTGATGG - Intergenic
1014897221 6:126917083-126917105 CAATATAAGAAAGAACTTGAGGG - Intergenic
1015240628 6:131019206-131019228 CAAAATATGTAAAATCTTTATGG - Intronic
1015407035 6:132849424-132849446 CAGTATATGTTAAAGGTTGAAGG - Intergenic
1015419400 6:132988398-132988420 CAATATCTGCAAAGACCTGAAGG - Intergenic
1016919539 6:149278250-149278272 CAATATTTGGAAAACCTTCATGG - Intronic
1017285515 6:152670894-152670916 CAATATATACTAAATCTGGAGGG + Intergenic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1018488969 6:164272300-164272322 GAATCTATGCAGAAGCTTGCAGG + Intergenic
1020518938 7:9162036-9162058 CAATATATGTAAGATATTGATGG - Intergenic
1020597784 7:10230688-10230710 CAAAATAAGTAAAAGCTTTAAGG + Intergenic
1020879271 7:13738635-13738657 TAATACATGCAAATGCTTGGAGG + Intergenic
1021490898 7:21219220-21219242 CAGTATATGCAAATGCCTTATGG - Intergenic
1024819252 7:53307768-53307790 AAACATATACAAAAGCTTGTAGG + Intergenic
1025294558 7:57765451-57765473 CAATATTTGAAAATGCTTGGTGG - Intergenic
1026619155 7:71935154-71935176 GAGTAGATGAAAAAGCTTGAGGG + Intronic
1027410942 7:77916971-77916993 CTATAGATGCTAAAGCTAGAAGG - Intronic
1027760959 7:82278202-82278224 CAATTTATTCAAAAGATGGAAGG + Intronic
1029729513 7:102430140-102430162 AAATATATACAAAAACTTGGTGG + Intergenic
1029981024 7:104879252-104879274 CAAAATATGCAAAAGTTAGCTGG + Intronic
1030442824 7:109609920-109609942 CAATATATGCAGAAACTCAAAGG + Intergenic
1032610228 7:133404529-133404551 CAATATGTGCAAAAGATTGGAGG - Intronic
1032911543 7:136437179-136437201 CAATAAAAGCAAAAGCTGCAAGG + Intergenic
1038891557 8:31730599-31730621 CAAGATATGCAAAACATAGAAGG + Intronic
1039129750 8:34249602-34249624 CAATAGATGCAATAGCATGATGG + Intergenic
1040828845 8:51654813-51654835 CATTATTTCCAGAAGCTTGAAGG + Intronic
1041217198 8:55612325-55612347 CAACATATTCAGTAGCTTGATGG - Intergenic
1042689279 8:71479284-71479306 CAATTTGAGCAAAATCTTGAAGG - Intronic
1048517547 8:135124494-135124516 CAGTGTATGCAAAAGCTGGAAGG + Intergenic
1048955985 8:139536368-139536390 CAATATAAACTAAAGCTTCATGG - Intergenic
1050079349 9:1899525-1899547 CAAGTTATGAAAAGGCTTGAAGG + Intergenic
1050834974 9:10065666-10065688 CAATATGTGGAAGAGCTGGAAGG + Intronic
1050962988 9:11760977-11760999 CAATATTTTAAAAAGTTTGAAGG - Intergenic
1052561124 9:30085759-30085781 CAATATGTGCAAAAGAGTAAAGG - Intergenic
1052602432 9:30652234-30652256 CAATATATGGAAAAGGTTTGAGG + Intergenic
1053639587 9:40058234-40058256 CAATAAATGAAAAAGTGTGATGG - Intergenic
1053766492 9:41406880-41406902 CAATAAATGAAAAAGTGTGATGG + Intergenic
1054161863 9:61678837-61678859 CAATATTTGAAAATGCTTGGTGG + Intergenic
1054320391 9:63654893-63654915 CAATAAATGAAAAAGTGTGATGG - Intergenic
1054545162 9:66318386-66318408 CAATAAATGAAAAAGTGTGATGG + Intergenic
1056017053 9:82400882-82400904 TAATATATGCCAAATCTAGAAGG + Intergenic
1057288505 9:93781557-93781579 CAATATATGCTAAAGATGGATGG - Intergenic
1058947496 9:109872139-109872161 CAATATATTAAAAAGCTATAGGG - Intronic
1059621136 9:116006851-116006873 TAGTATATGCAAAAGCATAAAGG + Intergenic
1060394697 9:123307269-123307291 CTTAAAATGCAAAAGCTTGAAGG + Intergenic
1062712204 9:137982081-137982103 CAAATTATCCAAAAGCTTGGTGG + Intronic
1202787459 9_KI270719v1_random:41929-41951 CAATAAATGAAAAAGTATGATGG - Intergenic
1185683485 X:1908214-1908236 CAAAATATTCATAAGCATGAAGG - Intergenic
1185987917 X:4856573-4856595 CAATATATGAAGAAATTTGAGGG + Intergenic
1188675169 X:32930654-32930676 CAACATGTACAAAAGCTTAAAGG - Intronic
1189904750 X:45746482-45746504 CAAGAGATGAAAAAGCTGGATGG + Intergenic
1190882121 X:54499010-54499032 CAGCATATGCAAAAACTTGGAGG - Intergenic
1192296161 X:69850838-69850860 TAGTATGTGCAAAAGCATGAAGG - Intronic
1193260323 X:79398849-79398871 CAACACAAGCAAAAGCTTTAAGG - Intergenic
1193276932 X:79600519-79600541 CAATATAAGCAAAAACCTCAAGG - Intergenic
1195954471 X:110314821-110314843 CAATATATGAACAAGCTGTATGG - Intronic
1196009063 X:110866888-110866910 CAAAATAAGCAAAAACTTGGAGG + Intergenic
1196466416 X:115976078-115976100 CAAAATATTCAACAGCTTAATGG + Intergenic
1197052761 X:122079664-122079686 TATTATATGCAAAAGTTAGATGG + Intergenic
1197308247 X:124870533-124870555 ACATTTAAGCAAAAGCTTGATGG + Intronic
1199076534 X:143532481-143532503 TAACATTTGCAAAATCTTGAAGG + Intergenic
1199581428 X:149364230-149364252 AAATATATTCTAAAGCTTCAGGG - Intergenic
1199930285 X:152511393-152511415 CAATATATGCTAAAGCTCACAGG + Intergenic
1199947931 X:152682443-152682465 CCATCTATGCAAAAGAGTGAGGG + Intergenic
1199961748 X:152786011-152786033 CCATCTATGCAAAAGAGTGAGGG - Intergenic
1199965671 X:152818557-152818579 GAATAAATGCAAAAGATAGAAGG + Intergenic
1201309936 Y:12587932-12587954 CAATATATGTAAAAGTATGTAGG + Intergenic