ID: 1088642748

View in Genome Browser
Species Human (GRCh38)
Location 11:111889211-111889233
Sequence CAATTCCTTCAGTCTTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 5, 2: 4, 3: 30, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088642745_1088642748 19 Left 1088642745 11:111889169-111889191 CCAGAGATGTCTCAAAGAGTAGA No data
Right 1088642748 11:111889211-111889233 CAATTCCTTCAGTCTTCTGATGG 0: 1
1: 5
2: 4
3: 30
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088642748 Original CRISPR CAATTCCTTCAGTCTTCTGA TGG Intergenic
901062773 1:6480613-6480635 CAATTATTTGATTCTTCTGATGG + Intronic
902183864 1:14710644-14710666 CACTTCCTGCAGGGTTCTGAAGG + Intronic
904224253 1:29001648-29001670 CAATGCCTTCAAAATTCTGAAGG - Intronic
904520040 1:31087993-31088015 CAAATCCTTAAGTCATCTTAGGG - Intergenic
909038822 1:70626346-70626368 CAATGCCTGCAGTCTGTTGAGGG - Intergenic
909677038 1:78250270-78250292 CTCTTCCTTCTATCTTCTGAAGG - Intergenic
911078489 1:93904438-93904460 TAATTTCTTCAGTTTTGTGAGGG - Intronic
911112241 1:94201692-94201714 TAATTTCTTCAGTATTTTGAAGG - Intronic
911556325 1:99349126-99349148 CTATTTTTTCAGTCTGCTGAAGG + Intergenic
912302085 1:108528480-108528502 CAATTCCTTCACAGTTCTGAAGG + Intergenic
913194647 1:116445377-116445399 TAATTCTTTCAGTGTTCTGAGGG + Intergenic
915080392 1:153348098-153348120 CACCTGCTTCAGTCTTCTCAGGG + Intronic
916936186 1:169630510-169630532 CTATTCCGGCAGCCTTCTGAGGG + Intergenic
919696555 1:200582517-200582539 CAATACTTTTATTCTTCTGAGGG - Intronic
920517121 1:206593587-206593609 CAATGCCTCCACTCTTCAGAGGG + Intronic
921343534 1:214158296-214158318 CTAAGCCTTCAGTCTTCTGCTGG - Intergenic
922354185 1:224760542-224760564 CATATCCTTCAGGCTTCTGTTGG - Intergenic
922979188 1:229811023-229811045 CAATGTCTTCAATATTCTGAGGG + Intergenic
923034349 1:230273868-230273890 CTATTCCTCCAGTTTTCAGAGGG + Intronic
923154889 1:231269417-231269439 CTATACCTCCAGTCTTCTGATGG - Intronic
924265823 1:242280925-242280947 CATTCCCTCAAGTCTTCTGAAGG - Intronic
1063040891 10:2336351-2336373 CAATTCCTTCAGAGCTCTGATGG - Intergenic
1063938904 10:11107464-11107486 CCATTCCTCCAGTCTTCTGTAGG - Intronic
1065910614 10:30300937-30300959 CAATGCCTTCAGAGTTCTGGTGG - Intergenic
1067298541 10:44990005-44990027 TAATTCTTTCAGGATTCTGAAGG + Intronic
1069169867 10:65213302-65213324 CTAGACCTTCAGTCATCTGAAGG + Intergenic
1070296581 10:75166546-75166568 CAGTTATTTCAGTGTTCTGAAGG + Intronic
1072668168 10:97409556-97409578 CAAATTCTTCATTCTTCTCAGGG + Intronic
1073735412 10:106339403-106339425 CCATTTCTTCAGATTTCTGAAGG + Intergenic
1074006497 10:109430372-109430394 CAATGACTTCAGTCTTAAGAAGG + Intergenic
1074172789 10:110960360-110960382 CAATTCATTTAGGCTTCTAATGG - Intronic
1074280350 10:112045659-112045681 CCATTCATCCAGTCTTCTGCCGG + Intergenic
1075598303 10:123748343-123748365 CAAGTCCTGAAGTCTTCTAACGG + Intronic
1075957257 10:126534752-126534774 CCATTCCTTCAATTTGCTGAGGG - Intronic
1078000534 11:7491268-7491290 CAATTCATTCAGTCCTCCCAGGG + Intronic
1080013801 11:27484094-27484116 GAATTCCTTCAGTCTTCTGATGG - Intergenic
1080443943 11:32320046-32320068 CATTTCTGTCAGGCTTCTGAAGG + Intergenic
1081184952 11:40030953-40030975 CTTTTCACTCAGTCTTCTGAGGG - Intergenic
1081738272 11:45420374-45420396 CAATTCCCTCAGTGTCCTGGGGG + Intergenic
1082954387 11:58853485-58853507 CAATTCCTCCAGGATACTGAGGG + Intronic
1083007741 11:59364315-59364337 CAAATGTTTCACTCTTCTGATGG - Intergenic
1083511115 11:63210197-63210219 CAAAGCCTTCCGGCTTCTGAAGG - Intronic
1084654333 11:70506392-70506414 CATTTGCTGCAGTCTGCTGAGGG - Intronic
1086328305 11:85727332-85727354 CTATTCCTACAGTGTTCTCAAGG - Intronic
1086427838 11:86704288-86704310 CAATTCCGTGAGGCTTCAGATGG + Intergenic
1087957049 11:104301510-104301532 TTAATCCTTCACTCTTCTGAGGG - Intergenic
1088642748 11:111889211-111889233 CAATTCCTTCAGTCTTCTGATGG + Intergenic
1089198393 11:116708705-116708727 GAAATCCATCAGTCTCCTGAAGG + Intergenic
1090591165 11:128270908-128270930 CAATTTCTTCAGAATTTTGAAGG - Intergenic
1090837989 11:130467228-130467250 ACACTCTTTCAGTCTTCTGATGG + Intronic
1092120416 12:6039792-6039814 CAACTCCTTCAGTCTTCACATGG + Intronic
1093020612 12:14200101-14200123 CCTTTCCCTCAATCTTCTGAGGG + Intergenic
1093572853 12:20688612-20688634 CACTTCCTCCAGTCCTCTGAAGG + Intergenic
1094069243 12:26394909-26394931 CAGTGCCTTCAGTTATCTGAGGG - Intronic
1094412126 12:30177769-30177791 TCATTCCTTGATTCTTCTGAAGG + Intergenic
1095341895 12:41099737-41099759 CAATTCTTTGAGTCATGTGAAGG - Intergenic
1095796727 12:46227148-46227170 CAATACCTTCAAAATTCTGAAGG + Intronic
1096190983 12:49619072-49619094 CAATGCCTTCATAATTCTGAAGG + Intronic
1096190984 12:49619077-49619099 GAATTCCTTCAGAATTATGAAGG - Intronic
1098702285 12:73644834-73644856 CTATGCCTTCTGTCTTCTGCAGG + Intergenic
1099515952 12:83596967-83596989 CAAATCTTTCAGTCTTAGGAAGG - Intergenic
1101041318 12:100758719-100758741 CTATTCCTTCACAGTTCTGAAGG + Intronic
1101098732 12:101370542-101370564 CACTGCCTTTGGTCTTCTGAAGG + Exonic
1102699259 12:114825007-114825029 GGATTCCATCAGTCTTCAGAGGG - Intergenic
1105562151 13:21503038-21503060 GAATTCCTTCAGTTTTCTAAAGG - Exonic
1108732744 13:53251784-53251806 CATTTCCTGCTTTCTTCTGAGGG - Intergenic
1109578350 13:64291943-64291965 CTTTTCATCCAGTCTTCTGAGGG + Intergenic
1113828044 13:113272047-113272069 CAATCCCTTCAAAGTTCTGAGGG - Intergenic
1115027667 14:28763023-28763045 GAATTCCCTCTGTCTTCTGAAGG + Intergenic
1115589148 14:34846448-34846470 AAATTTCTTCAGTGTTCTAAGGG - Intronic
1117059420 14:51946873-51946895 CAATTCTTTCAGTCTTCAGGAGG + Intronic
1117830756 14:59747197-59747219 CAATTCCTTCATTCCACTGGTGG + Intronic
1120281908 14:82450025-82450047 AAAATCATTCAGGCTTCTGAAGG + Intergenic
1121663766 14:95656026-95656048 CAATGCCTTCAAAGTTCTGAGGG - Intergenic
1121712853 14:96052331-96052353 CAATTCTTTCAGCCTCCTGTGGG - Intronic
1122693763 14:103543196-103543218 CCATTCCTTCATTCTGCAGATGG + Intergenic
1123960020 15:25388068-25388090 CCTTTGCTTCTGTCTTCTGAAGG - Intronic
1124134033 15:27018325-27018347 CAAATCCTTCAGAGCTCTGATGG - Intronic
1127984034 15:64054829-64054851 CAATTCATGCACTATTCTGATGG - Intronic
1128068525 15:64779062-64779084 CAACTCTTTCAGACATCTGAAGG + Intergenic
1128988171 15:72236377-72236399 CAATTTCTTCAGGCCTATGAGGG + Intergenic
1129964117 15:79718558-79718580 CAACTCCATCATTCTACTGATGG - Intergenic
1131320348 15:91383898-91383920 CAACTCCTTTGGTCTTCTTATGG + Intergenic
1131971913 15:97902085-97902107 CAATGCCTTCATTCTCCTGGGGG - Intergenic
1132070670 15:98774359-98774381 CACATCCTTCAGTCTTTTGTGGG - Intronic
1134088914 16:11379509-11379531 TAAGTCTCTCAGTCTTCTGATGG + Intronic
1136465405 16:30439743-30439765 CAATGCCTTCAAAATTCTGAGGG - Intergenic
1137052933 16:35728555-35728577 CAATGCCTGCAGTTTGCTGAGGG + Intergenic
1137585295 16:49660634-49660656 CAATTACTCCAGTCTTCAGTGGG + Intronic
1137960107 16:52874395-52874417 TAATTCCTTAAGGATTCTGATGG + Intergenic
1141979680 16:87542177-87542199 CAGTTCCTTCAGGCTGCAGAAGG - Intergenic
1144156653 17:12510605-12510627 TAATAATTTCAGTCTTCTGATGG - Intergenic
1144521418 17:15954832-15954854 CAACCCCTTCAGACATCTGAGGG - Intronic
1144598067 17:16588421-16588443 TAGTTCCTTCAGTTCTCTGATGG + Intergenic
1145392729 17:22468356-22468378 CTCTTCCTGCAGTCTTCTAAGGG - Intergenic
1146146339 17:30420769-30420791 TAATTTCTTCAGTCTTTTGGAGG + Intronic
1146999202 17:37348520-37348542 CAATGCCTTCAAAATTCTGAAGG + Intronic
1148963770 17:51417116-51417138 CATTTCCCTGAGACTTCTGAGGG - Intergenic
1149248897 17:54745128-54745150 CATTTGCTTCAGTTTTCTCAAGG - Intergenic
1149869991 17:60172370-60172392 CACTTCCTTCAGTCTTCTTGGGG + Intergenic
1153049358 18:886513-886535 CAATTCTCTCAGTCTGCTAATGG + Intergenic
1153842055 18:9016107-9016129 CAATTACTTCTGTCGACTGAAGG + Intergenic
1153943506 18:9997360-9997382 AGATTCCTTAACTCTTCTGAAGG - Intergenic
1154088762 18:11336500-11336522 CCTTTCCTTCAGTCCTCTCAAGG - Intergenic
1156655081 18:39275501-39275523 CAATATATTCAGTTTTCTGAGGG + Intergenic
1157303389 18:46497363-46497385 CAATTCCTTCCATCTCCTCACGG - Intronic
1158032642 18:52985369-52985391 CAATGTCTTCAGAGTTCTGAGGG - Intronic
1158842379 18:61401843-61401865 AATTTCTTTCACTCTTCTGAAGG - Intronic
1166119909 19:40680034-40680056 GAATTCCTTCCTACTTCTGAAGG - Intronic
1168362967 19:55758218-55758240 CAATTCCTTTTGTCTCATGAAGG - Intergenic
1168363922 19:55768218-55768240 CAATTCCTTTTGTCTCATGAAGG - Intergenic
1168466670 19:56607846-56607868 CAAGATCTTCAGTCTTCTCAGGG + Intronic
925158428 2:1664251-1664273 CCATCCCTTCAGCCCTCTGAGGG - Intronic
928137820 2:28701622-28701644 AAATTCCTTCTGTCTTTTCAAGG + Intergenic
929976113 2:46636635-46636657 CAATGCCTTCAACATTCTGAAGG - Intergenic
929980255 2:46671850-46671872 CAACAACATCAGTCTTCTGAAGG + Intergenic
930052232 2:47225422-47225444 CAACTCCTTCAGTGGTCTTAGGG + Intergenic
930822452 2:55660649-55660671 TGATTCCTTTAGTCCTCTGAAGG - Intronic
930867560 2:56136827-56136849 CAGTTCCTTCAAGGTTCTGAGGG - Intergenic
933052346 2:77615380-77615402 CAACTTCTTCAGTCTTGGGAGGG - Intergenic
933075287 2:77917383-77917405 TAACTCCTAAAGTCTTCTGAAGG + Intergenic
933383329 2:81579376-81579398 AAATTTCATCAGTCTTCTCATGG - Intergenic
933929817 2:87138073-87138095 CAATCCCCTGAGTATTCTGAGGG + Intergenic
935569071 2:104640202-104640224 CAATAACATCAGTTTTCTGAAGG + Intergenic
935603239 2:104943959-104943981 CATTTCCTTCTGTCTTTTCATGG - Intergenic
936363120 2:111825327-111825349 CAATCCCCTGAGTATTCTGAGGG - Intronic
936982178 2:118275144-118275166 CATCTCCTTCAGGCTTCTTATGG - Intergenic
936989130 2:118344045-118344067 CAATGCCTTCGATGTTCTGAAGG - Intergenic
937649517 2:124304484-124304506 CAGATCCTTCAGGTTTCTGATGG + Intronic
937922905 2:127144607-127144629 CAATGTCTTCAGTATTCCGAGGG - Intergenic
938367474 2:130746091-130746113 CAATTCCTTTATAATTCTGAGGG + Intergenic
938738242 2:134205833-134205855 GAATTGCTTCAGTGTCCTGAAGG + Intronic
939519364 2:143210246-143210268 AAATTTCTTCAGTCTTCTGGAGG - Intronic
940088368 2:149887454-149887476 CAATTCCTTAAGTTCTCTGTAGG + Intergenic
942011024 2:171762403-171762425 CCGCTCCTTCAGTATTCTGAAGG + Intergenic
942973440 2:181985292-181985314 CAATCCCCTCATTTTTCTGATGG + Intronic
943229148 2:185223204-185223226 GAATTACTTCAGTCTTCTGAGGG + Intergenic
943669296 2:190644244-190644266 CAATTCTTTCAGTCCTTCGAAGG - Intergenic
943775473 2:191761164-191761186 GAATGCTTTCAGACTTCTGACGG + Intergenic
944780699 2:203014541-203014563 CATTTCCGTGAGTCATCTGAGGG - Intronic
944961387 2:204878223-204878245 CAATTTCTTCAGTCCTTTGATGG - Intronic
945011143 2:205464906-205464928 TAATTCCTTAAGGCTTCCGAGGG - Intronic
945101069 2:206262781-206262803 TATTTCTTTCAGTCTTCAGAAGG + Intergenic
945655732 2:212620847-212620869 CAATTACATCAGTATTCTGATGG - Intergenic
946003303 2:216501370-216501392 CAACTCCTTCAGTCTTCTGATGG - Exonic
948684445 2:239661349-239661371 AGATTTCTTCAGTGTTCTGATGG + Intergenic
1169630626 20:7626572-7626594 CAATTCCTTAAGTCTACACAGGG + Intergenic
1170054006 20:12178791-12178813 CAATTCTTGCAGTGTGCTGAGGG + Intergenic
1173625085 20:44466576-44466598 CAACTCCTTCAGGCTTCTGATGG + Intergenic
1175740707 20:61417921-61417943 CCATCCCTTGAGTTTTCTGAGGG + Intronic
1177165146 21:17593160-17593182 TAATTCCATCAGTCTTGTAAGGG - Intronic
1178307653 21:31503768-31503790 CAACCTCTCCAGTCTTCTGAGGG - Intronic
1178554043 21:33570505-33570527 CAATTTCTGCAGTTTGCTGAGGG + Intronic
1180445690 22:15411189-15411211 CAACTGCTTCTGTGTTCTGAGGG + Intergenic
1181679826 22:24486309-24486331 CACTTCATTCAGATTTCTGAAGG - Intergenic
1183754161 22:39743698-39743720 CAGGTCCCCCAGTCTTCTGAGGG - Exonic
1183978960 22:41528582-41528604 CAGTTCCTTCATTCTGTTGAGGG - Exonic
1184061227 22:42083050-42083072 GAATTCTTTCAGTCTGCGGATGG + Intronic
1184835345 22:47017629-47017651 CAATTTCCTCCGTTTTCTGATGG - Intronic
949619234 3:5791451-5791473 CATTTGTTTCAGCCTTCTGATGG + Intergenic
950361315 3:12451346-12451368 CTGTTCCTTCCCTCTTCTGAGGG - Intergenic
950836893 3:15929031-15929053 CATTTCCCTCAGCCTTCAGAAGG - Intergenic
951047592 3:18057912-18057934 TTATTCCTTCAGTCTCATGAAGG - Intronic
951357209 3:21682495-21682517 CTATCCTTTCAGTCCTCTGATGG - Intronic
951851598 3:27147289-27147311 CACTTCCCTCTCTCTTCTGATGG - Intronic
954935682 3:54324341-54324363 CATTTACTTCAGACATCTGACGG - Intronic
955022623 3:55135707-55135729 CAATTTTATCAGTCTTCTCAAGG - Intergenic
958469574 3:94499978-94500000 CAATTTCTTAAGTGTTTTGAAGG - Intergenic
958922090 3:100118828-100118850 CAATTCTTTCAGTTATCTGTAGG - Intronic
959332624 3:105024906-105024928 CAATTCCTTCAAGATTCTGGTGG - Intergenic
959385973 3:105707252-105707274 CAATTCATACTGTGTTCTGAAGG + Intronic
959704065 3:109323939-109323961 CAATTCTTACACTCTTCTGCAGG + Intergenic
959888874 3:111532106-111532128 CAGTTATTTCAGTCTTCTCATGG - Intronic
959975835 3:112458361-112458383 CAATTCCTTCCTTCTACTGATGG + Intergenic
960161597 3:114356086-114356108 CAATTCCTTCCATGTTTTGAGGG - Intronic
960576355 3:119233575-119233597 CAATTCCTTCCATATACTGAGGG + Intronic
961147769 3:124609636-124609658 CAATGCCTTGAGTCATCTGCCGG - Intronic
961498586 3:127314062-127314084 TAATACCTGCAGTCTTCTGTGGG - Intergenic
962589562 3:136874869-136874891 CAAGGCCTTCAGAATTCTGAAGG - Intronic
966006343 3:175017840-175017862 CAGTCCCTTCTGTCTTCTGTGGG + Intronic
966465596 3:180228092-180228114 GAAGTCCTTCCTTCTTCTGAAGG + Intergenic
969919995 4:10529377-10529399 AGATTCCTGCAGTCATCTGAAGG + Intronic
970487436 4:16538704-16538726 CAATTGACTCAGTCTTATGATGG - Intronic
970673634 4:18423277-18423299 CAATCCCTTCAGGCTTTGGATGG - Intergenic
972470593 4:39400077-39400099 CCCTTCCTTGAGTCTTCTGGTGG - Intergenic
972767076 4:42160995-42161017 AAATTTCTTCAGTTCTCTGAAGG - Intergenic
973006877 4:45019264-45019286 CAAAGTCTTCTGTCTTCTGATGG + Intergenic
973545551 4:51978091-51978113 CAACTCCTTCAGTCTTCTGATGG + Intergenic
977153166 4:93539727-93539749 CAATGCATTCAAACTTCTGAAGG - Intronic
977499619 4:97822581-97822603 TAATTGGTTCAGTGTTCTGAAGG + Intronic
978237779 4:106480625-106480647 CAATCCCTTGTGGCTTCTGAAGG + Intergenic
978820560 4:112959778-112959800 CAATTCTCTCAATCTTCTTAAGG - Intronic
979633781 4:122933908-122933930 CATTTCCTTCTGTCTCCAGATGG + Intronic
981455739 4:144951708-144951730 CAAATGCTTGAGTCTTCTTAAGG - Intergenic
982621978 4:157719617-157719639 TATTTTCTTCAGTCTTTTGAAGG - Intergenic
983433089 4:167676148-167676170 AAACTCCTTCAGTCCTATGAAGG + Intergenic
983558232 4:169077160-169077182 CCGTTCCTTCTGGCTTCTGAGGG - Intergenic
984361559 4:178741474-178741496 CTATTAATTCAGTCTTCTGGAGG - Intergenic
984996451 4:185435237-185435259 CAATACCTTCAGTCTACAAATGG - Intronic
985419937 4:189774790-189774812 CAATTCATTCTGTTTTCTTAAGG - Intergenic
985951354 5:3223661-3223683 CCATTCACTAAGTCTTCTGAGGG + Intergenic
986897768 5:12391428-12391450 CAATATCTTCAATGTTCTGAGGG - Intergenic
988068493 5:26254621-26254643 CAAATCTTGCAGTCTTTTGAAGG + Intergenic
988407668 5:30844751-30844773 CAATCCATTCAGTCTGCTAAAGG - Intergenic
989029891 5:37107892-37107914 CATTTCCTTCAGCCTTTTGATGG - Intronic
989151583 5:38305310-38305332 CAATTACTTCAAAATTCTGAAGG + Intronic
989381788 5:40816559-40816581 CATTTCCTTCAGAATTTTGAAGG + Intergenic
989381789 5:40816564-40816586 CAATACCTTCAAAATTCTGAAGG - Intergenic
989468438 5:41785745-41785767 GTATTCCTTCAGCCTGCTGAGGG - Intronic
989474148 5:41855518-41855540 TAATTCCTTTAGTGCTCTGATGG + Intronic
989515205 5:42335371-42335393 CACTTGCTTCTGTCTTTTGAAGG - Intergenic
991195700 5:63929833-63929855 CAATTTCTTTAGGCTTTTGAGGG - Intergenic
991414104 5:66374323-66374345 CAATTTCTACAGAATTCTGATGG - Intergenic
992678979 5:79134203-79134225 CAAGCCCTTCAGTGTGCTGAAGG - Intronic
992829402 5:80579710-80579732 CAATGCCTTCAGATTTTTGAAGG + Intergenic
995114798 5:108467633-108467655 CACTTCATTCAGTTTACTGATGG + Intergenic
995156497 5:108920502-108920524 CCATTCCCACAGTCTTCTTAGGG + Intronic
995761992 5:115572945-115572967 CAATACTTTGAGTCTTCTGGAGG + Intergenic
996232112 5:121078451-121078473 CCATTCCCACAGACTTCTGAAGG + Intergenic
997435619 5:133872545-133872567 CAATGCCTTCAAATTTCTGAGGG + Intergenic
997525486 5:134550434-134550456 CAGTTCACTCAGCCTTCTGAAGG - Intronic
997935795 5:138109561-138109583 CAATTCCTTCATGCTTCTCAGGG - Intergenic
1000181387 5:158814889-158814911 AATTTCCTTCAGGTTTCTGAAGG + Intronic
1000565565 5:162842707-162842729 CAATTCCTGCAGTCATATGTTGG - Intergenic
1004426019 6:15507704-15507726 CAATTCCTTAAGGCTACTGCAGG + Intronic
1004483335 6:16041391-16041413 GACTTCCTTCAGTCGTCTGAAGG - Intergenic
1005130322 6:22499411-22499433 CATTTCCTTCTGTGTTCTGTGGG + Intergenic
1005321264 6:24656700-24656722 GAATGCCTTCAGAATTCTGAAGG + Intronic
1005833226 6:29687523-29687545 CTATTCCTTTCCTCTTCTGAGGG + Intergenic
1005966958 6:30733398-30733420 GAATGCCTTCAGAATTCTGATGG - Intronic
1006140812 6:31928493-31928515 CACTTCCCTCAGTCTCCTGAGGG - Intronic
1006528486 6:34628790-34628812 CATTTGCTTCTATCTTCTGAAGG + Intronic
1007287320 6:40757027-40757049 AAAGCCCTTCAGTCCTCTGAAGG - Intergenic
1007401333 6:41604256-41604278 TAATTCAGCCAGTCTTCTGAAGG - Intergenic
1007481826 6:42155320-42155342 CAATTCCTTCTGTCTTCCCAAGG - Intergenic
1009306043 6:62090217-62090239 CAATTCCTTTAGTATGGTGAAGG - Intronic
1010499241 6:76575254-76575276 CAATTCTGTCTGACTTCTGAAGG - Intergenic
1011122624 6:83970433-83970455 CAATTCATTCAGTTATCTGTGGG - Intergenic
1011213584 6:84980946-84980968 CCATCCATTCAGTCTTCTGTGGG + Intergenic
1012227950 6:96726415-96726437 GAAATCCCTCATTCTTCTGATGG - Intergenic
1014469950 6:121801629-121801651 CTAGGCCTTCAGGCTTCTGATGG - Intergenic
1015661650 6:135581921-135581943 CTATACCTTCAGCCTTCTGTAGG + Intergenic
1016220740 6:141667641-141667663 GATATCCTTCAGTATTCTGATGG - Intergenic
1018373066 6:163186332-163186354 GAATTCCCTCAGTAATCTGAGGG - Intronic
1020343434 7:7137496-7137518 CACTTCCTTTACTCTCCTGAGGG - Intergenic
1020637191 7:10711522-10711544 CCTCTCCTTCAGTTTTCTGAGGG + Intergenic
1020996428 7:15271547-15271569 CAAGTCCAGGAGTCTTCTGAAGG + Intronic
1021010330 7:15455702-15455724 CAATGCCTTCAAAATTCTGAAGG - Intronic
1021330824 7:19337411-19337433 CAATTTCTTCATTCTTCAGAAGG + Intergenic
1022585739 7:31607470-31607492 TATTTCCTTCAGAATTCTGAAGG + Intronic
1022585740 7:31607475-31607497 CAAGGCCTTCAGAATTCTGAAGG - Intronic
1023086916 7:36579929-36579951 CAATTCCTTCAGACTTGTGAGGG - Intronic
1023664102 7:42502382-42502404 GAACTGCCTCAGTCTTCTGAGGG - Intergenic
1027253066 7:76411149-76411171 CCATTCCTTCCGTCATCTCAGGG + Intronic
1028228328 7:88275504-88275526 AAAATCCTTCACTCTTCTAAAGG - Intergenic
1028717017 7:93982544-93982566 CCATACCTTCAGTCTCTTGAGGG - Intronic
1030251491 7:107450328-107450350 CAATTTCTTCAGTCTTCTGATGG - Intronic
1030558304 7:111054002-111054024 CAATTCATTGATTCTTCTCATGG - Intronic
1031183473 7:118446286-118446308 CCATGAGTTCAGTCTTCTGATGG - Intergenic
1031628154 7:124014368-124014390 TCATTCCCTCAGTCTTCAGAAGG - Intergenic
1031704651 7:124964821-124964843 CAATTCCTCCCTTCTCCTGAAGG + Intergenic
1032233981 7:130103642-130103664 AAATGCCTTCAGTGTTCTGAGGG + Intronic
1032327756 7:130947792-130947814 CAATTCCTACTGTTTTCTGAAGG - Intergenic
1032571572 7:133005666-133005688 CCATTCCTTCATTTTTTTGAAGG - Intronic
1033035243 7:137869617-137869639 CAATTCCTTTAAAATTCTGAAGG + Intergenic
1033186045 7:139227549-139227571 CAATTGCTTCAGTCTTCTGATGG + Intergenic
1034083924 7:148306124-148306146 AAATTCCTTCAAACTTGTGAAGG - Intronic
1034886088 7:154800058-154800080 ATATTCCTTCAGTTTTCTGGGGG - Intronic
1035138885 7:156737248-156737270 CAATGCCTTCAGAATTCTGAAGG - Intronic
1035534196 8:378648-378670 CAATTCCTTCAGGCTTGGGGAGG + Intergenic
1035869814 8:3125611-3125633 CAATTCCTAAAGACTTCTGAAGG + Intronic
1037044802 8:14285219-14285241 CATTTCATTCATTCTTCTGGAGG + Intronic
1037166402 8:15834694-15834716 TAATTCATTCAGTATTCTGTTGG + Intergenic
1037227743 8:16614338-16614360 CAAGTCACTCAGTCTTTTGAGGG + Intergenic
1037270518 8:17124784-17124806 CAATGCTTTCAGAATTCTGAGGG - Intergenic
1038182165 8:25239647-25239669 CAACTCCTTCATTCGTCTGCTGG - Intronic
1040543324 8:48378707-48378729 AAATTCCTTCAGTGCTTTGAAGG + Intergenic
1041527552 8:58824143-58824165 CACTGCCCTCAGTCTTCTGCTGG - Intronic
1042494252 8:69438442-69438464 CAATTCCTTTAAACTTCTGAAGG + Intergenic
1043052579 8:75402348-75402370 CAGTCGCTTCATTCTTCTGAAGG - Intergenic
1043209494 8:77493144-77493166 GCATTCCTTATGTCTTCTGAAGG - Intergenic
1043889114 8:85636711-85636733 CAAATCTTTCATTCTTCAGATGG + Intergenic
1044687693 8:94843605-94843627 CAATTTCTTCAGTCTTATGATGG + Intronic
1044734119 8:95260304-95260326 CAATATCTTCAGTGTTCTTATGG - Intronic
1045445037 8:102252775-102252797 CATGTGGTTCAGTCTTCTGAAGG + Intergenic
1047994626 8:130322492-130322514 CAAATCCTTCAGGCTGCAGATGG + Intronic
1050131363 9:2415893-2415915 CAATGCCTTCAGAATTTTGAGGG - Intergenic
1051398840 9:16657602-16657624 CATTCCCTTCAGCCTACTGATGG - Intronic
1054722684 9:68618896-68618918 CAAAGCCTTCAAACTTCTGAAGG - Intergenic
1054755568 9:68954097-68954119 AAAATCCTCCAGTCTTCTGTTGG + Intronic
1057376546 9:94529122-94529144 CACTTCCTTCTATCTTCTGTTGG + Intergenic
1058449079 9:105079475-105079497 CACTTCCTTCACTCTTGTTAGGG - Intergenic
1059047272 9:110882539-110882561 CAATTCCTACACACTTTTGAAGG + Intronic
1060652842 9:125344994-125345016 CAATTCCCTGAGTATGCTGAAGG - Intronic
1186146111 X:6625754-6625776 CACTGCCTTCAGTCTTTGGAGGG - Intergenic
1186245580 X:7613119-7613141 CAATTCATCCTGTATTCTGAAGG + Intergenic
1186405489 X:9298418-9298440 TAATTGCTGCAGTCTTCAGAAGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1187522421 X:20025499-20025521 TCTTTCCTTCAGTCTTCTGAGGG - Intronic
1188127536 X:26388249-26388271 TAATTCTTTCAGTTTACTGAAGG - Intergenic
1188570971 X:31584703-31584725 CAATTCTCTCCCTCTTCTGATGG - Intronic
1188777190 X:34234436-34234458 AAATTCCTTCAGTCTGGTTAGGG - Intergenic
1189067414 X:37825121-37825143 CAATTCCTTCTGTTTTTTTAAGG - Intronic
1190133424 X:47772139-47772161 CCATGACTTCAGTCTTCTGATGG + Intergenic
1190500416 X:51071441-51071463 CAATTCCTTTAATATTCTGTTGG - Intergenic
1190879788 X:54483998-54484020 CAATCCCTTCAGCCTTGTGAAGG + Intronic
1196626963 X:117887608-117887630 CACTACCTTCAGACTTCTAAGGG + Intergenic
1198212248 X:134527253-134527275 CAATGCCTTCAATATTCTGAAGG - Intergenic
1198234440 X:134723771-134723793 CAATTACTTCACTCTTTTAAAGG - Intronic
1198563251 X:137875572-137875594 CAATTTCATCAGTCTTTTCAAGG - Intergenic
1198959349 X:142167961-142167983 CAATTCCTTAAGTCTTGGCAGGG + Intergenic
1201464101 Y:14260886-14260908 CAATTCATCCTGTATTCTGAAGG + Intergenic