ID: 1088646461

View in Genome Browser
Species Human (GRCh38)
Location 11:111920452-111920474
Sequence CCTCTGTCTCCCAAGCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2271
Summary {0: 1, 1: 0, 2: 27, 3: 228, 4: 2015}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088646461_1088646464 17 Left 1088646461 11:111920452-111920474 CCCTTAAGCTTGGGAGACAGAGG 0: 1
1: 0
2: 27
3: 228
4: 2015
Right 1088646464 11:111920492-111920514 TGCGCCACTGCAGTCCAGACTGG 0: 4
1: 337
2: 21462
3: 119808
4: 210819
1088646461_1088646465 18 Left 1088646461 11:111920452-111920474 CCCTTAAGCTTGGGAGACAGAGG 0: 1
1: 0
2: 27
3: 228
4: 2015
Right 1088646465 11:111920493-111920515 GCGCCACTGCAGTCCAGACTGGG 0: 9
1: 1015
2: 55282
3: 193562
4: 242722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088646461 Original CRISPR CCTCTGTCTCCCAAGCTTAA GGG (reversed) Intronic
Too many off-targets to display for this crispr