ID: 1088648417

View in Genome Browser
Species Human (GRCh38)
Location 11:111936894-111936916
Sequence CTTGCAGGCGGGTGTGCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088648417_1088648423 3 Left 1088648417 11:111936894-111936916 CCACGGGCACACCCGCCTGCAAG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1088648423 11:111936920-111936942 GGTGTGTGTGTGCGCGCGCGCGG 0: 1
1: 19
2: 58
3: 217
4: 1103
1088648417_1088648424 30 Left 1088648417 11:111936894-111936916 CCACGGGCACACCCGCCTGCAAG 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1088648424 11:111936947-111936969 AAGCGCATGCATACGCCAGCCGG 0: 1
1: 0
2: 1
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088648417 Original CRISPR CTTGCAGGCGGGTGTGCCCG TGG (reversed) Intronic