ID: 1088648585

View in Genome Browser
Species Human (GRCh38)
Location 11:111937669-111937691
Sequence TCGCCCCCAGAACCCCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088648578_1088648585 3 Left 1088648578 11:111937643-111937665 CCATCCTTTGGGGACCCCAGAGC 0: 1
1: 0
2: 0
3: 24
4: 235
Right 1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 112
1088648579_1088648585 -1 Left 1088648579 11:111937647-111937669 CCTTTGGGGACCCCAGAGCAAAT 0: 1
1: 0
2: 1
3: 18
4: 142
Right 1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 112
1088648577_1088648585 6 Left 1088648577 11:111937640-111937662 CCTCCATCCTTTGGGGACCCCAG 0: 1
1: 0
2: 1
3: 22
4: 248
Right 1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 112
1088648570_1088648585 26 Left 1088648570 11:111937620-111937642 CCGGAAGGGGTCCTCCTCCTCCT 0: 1
1: 0
2: 3
3: 33
4: 317
Right 1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 112
1088648576_1088648585 9 Left 1088648576 11:111937637-111937659 CCTCCTCCATCCTTTGGGGACCC 0: 1
1: 0
2: 1
3: 24
4: 321
Right 1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 112
1088648575_1088648585 12 Left 1088648575 11:111937634-111937656 CCTCCTCCTCCATCCTTTGGGGA 0: 1
1: 0
2: 4
3: 33
4: 423
Right 1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 112
1088648571_1088648585 15 Left 1088648571 11:111937631-111937653 CCTCCTCCTCCTCCATCCTTTGG 0: 1
1: 1
2: 19
3: 145
4: 1210
Right 1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG 0: 1
1: 0
2: 1
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088648585 Original CRISPR TCGCCCCCAGAACCCCAAAG GGG Intronic
902147038 1:14410809-14410831 CGGCCACCAGAACCCGAAAGAGG + Intergenic
902962275 1:19972763-19972785 TCGCCCCATGAACCCCAATTGGG - Intergenic
903542810 1:24106353-24106375 TCACCCCCACACCCCCACAGTGG - Intronic
905694993 1:39967547-39967569 CCCTTCCCAGAACCCCAAAGTGG - Intronic
910173026 1:84398624-84398646 CTGCCCCCAGCACCCCAAAGAGG - Exonic
912442775 1:109712069-109712091 GGGCGCCCAGAAGCCCAAAGCGG - Intergenic
919290514 1:195623918-195623940 TCTCCTCCAGAACCCCAGAATGG + Intergenic
922748793 1:228061156-228061178 GCGCCCCAAGAGCCCAAAAGAGG + Exonic
924477785 1:244396360-244396382 TTGCCTCCAGAAATCCAAAGAGG + Intergenic
1069918950 10:71804538-71804560 TCTCCCGCAGGACCTCAAAGAGG - Intronic
1069950849 10:72017135-72017157 TCGGCTCCAGTTCCCCAAAGTGG - Intergenic
1070793967 10:79206290-79206312 CTGCACCCAGAGCCCCAAAGTGG + Intronic
1072174778 10:92908816-92908838 TAGCCCCCAAAGCCCAAAAGAGG + Intronic
1073018165 10:100418782-100418804 ACACCCCCAAAACCCCACAGTGG + Intergenic
1074962916 10:118464007-118464029 CCACCCCCAGAACCCCAAATGGG - Intergenic
1075864466 10:125705839-125705861 TCCACCCCAGAACCCCCATGGGG + Intergenic
1076217058 10:128703604-128703626 GCGTGCACAGAACCCCAAAGAGG - Intergenic
1077416484 11:2426503-2426525 TCCACCCCAGAACTCCCAAGAGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1082206715 11:49444574-49444596 TCAGCCCCAGTATCCCAAAGTGG - Intergenic
1083626328 11:64073888-64073910 TCAACCCCAGAGCCCCTAAGTGG - Intronic
1083759964 11:64810362-64810384 GCGCCCCAAGCACCCCAATGAGG + Intronic
1084179020 11:67437410-67437432 TGGCCCCCAGCACCCCATACCGG - Intronic
1084531170 11:69728742-69728764 GGACCCCCAGGACCCCAAAGAGG + Intergenic
1085604212 11:77882690-77882712 CCACCACTAGAACCCCAAAGGGG + Intronic
1086648552 11:89257186-89257208 TCAGCCCCAGTATCCCAAAGTGG + Intronic
1088648585 11:111937669-111937691 TCGCCCCCAGAACCCCAAAGGGG + Intronic
1096463243 12:51834412-51834434 TCTCCCACAGAAGCCCAATGGGG - Intergenic
1096513611 12:52144960-52144982 TCACCCCCAGAATCCCAGACAGG - Intergenic
1097688018 12:62709288-62709310 TCTCCCCTAGAATCCCCAAGAGG + Intronic
1102915406 12:116748678-116748700 TGGCCCCCAGTTCCCCAGAGGGG - Intronic
1102998070 12:117364858-117364880 TCTCCCCCTGAACCCCAGAGAGG - Intronic
1108162943 13:47661714-47661736 AACCCCCCAAAACCCCAAAGAGG - Intergenic
1109885124 13:68532050-68532072 TCCATCCCAGAACCCCCAAGAGG - Intergenic
1119046462 14:71321629-71321651 TGTCCCCAAGACCCCCAAAGGGG - Intronic
1122034340 14:98936543-98936565 TCTCCCCTAGAACCTCCAAGAGG + Intergenic
1122856362 14:104562102-104562124 TGGGCCCCAGAACCACAACGAGG + Intronic
1126984060 15:54282534-54282556 ACGACCCCAAAACCCCAGAGGGG + Intronic
1128462866 15:67884587-67884609 TTCCCTCCAGAACCCCACAGCGG + Intergenic
1128876081 15:71202484-71202506 TGGCCTGCAGAAGCCCAAAGTGG + Intronic
1131309173 15:91272134-91272156 GAGCCCCCAGATCCCCAAAAAGG - Intronic
1131741857 15:95401415-95401437 TGGACCCCAGACCCCAAAAGTGG + Intergenic
1137784203 16:51124444-51124466 TCTCCCCCAGAACCACGATGGGG + Intergenic
1139001632 16:62518090-62518112 CAGCCACCAGAACCCGAAAGAGG + Intergenic
1139422430 16:66856900-66856922 TTGCTCCCAGGACCCCAGAGGGG + Intronic
1142286135 16:89172242-89172264 TGGCCCCCAGCCCCCCAGAGAGG - Intronic
1143131705 17:4682632-4682654 TCTCCCCCAGCACCCCACAAGGG + Intronic
1143384965 17:6523692-6523714 TCATCCCAAGAACCCCAGAGGGG - Intronic
1146438820 17:32876560-32876582 ACGCCCCCCGCACCCCAAAGCGG + Intronic
1149598875 17:57880614-57880636 TCTTCCCCAGAAGCCCAGAGAGG + Intronic
1151492352 17:74440139-74440161 TGGCGAACAGAACCCCAAAGAGG - Exonic
1160686345 19:438673-438695 GCGTCCCCAGACCCCCAGAGGGG - Intronic
1160854690 19:1211446-1211468 CCCCCCCCAGAACCCCACTGTGG - Intronic
1162253988 19:9472590-9472612 TCACCCCCAGATCCCCAAATGGG + Intronic
1162672182 19:12266503-12266525 CCGCCCTCAGAACCCCTAATTGG + Intronic
1165795319 19:38516027-38516049 TGGGACCCAGGACCCCAAAGAGG + Intronic
1167529157 19:50004184-50004206 CCTCCCCCAGAAACCCACAGTGG - Intronic
927393139 2:22618798-22618820 ATTCCCCCAGAACCCCAAGGTGG + Intergenic
931304224 2:61012995-61013017 TCGGCCCCACAACCACAAAGTGG - Intronic
936372972 2:111918473-111918495 TCAACCCCAGACCCCCAGAGGGG + Intronic
937229496 2:120389299-120389321 TAGCCCTGAGAACCCCACAGGGG - Intergenic
939022282 2:136972837-136972859 TTGCCCCCACACCCCCAAAAAGG - Intronic
939773760 2:146358664-146358686 TGGCCCCCAGAGCCCTAAACAGG + Intergenic
946146003 2:217731492-217731514 TAACCCCCAGCACCCCAAAATGG - Intronic
947913325 2:233816751-233816773 TAGAGCCCAGAACACCAAAGTGG - Intronic
948150258 2:235739226-235739248 TCGCCCCCAGACCCCGATACTGG - Intronic
948556494 2:238814781-238814803 TTGCCACCAGAGCCCCATAGAGG - Intergenic
1172143835 20:32743011-32743033 TCGGCCCCAGGACCCCGCAGAGG + Intronic
1174171619 20:48621208-48621230 TCTCCTCCAGGGCCCCAAAGTGG - Intergenic
1174384749 20:50180519-50180541 CCTCCCCCAGAACACAAAAGTGG - Intergenic
1174436390 20:50510185-50510207 CCGAGCCCAGAGCCCCAAAGCGG + Intergenic
1177384978 21:20397021-20397043 ACGACCCCAAAACCCCACAGTGG + Intergenic
1179798645 21:43799983-43800005 TCCCCACCAGCACCCCAACGAGG - Intronic
1179954446 21:44730452-44730474 TCACCCCTCCAACCCCAAAGTGG + Intergenic
1181031175 22:20149464-20149486 TGGCCCCCAGAACCTCAAGAAGG - Exonic
1181421276 22:22800722-22800744 TCAGCCCCAGAACCTCAAAATGG - Intronic
1181512162 22:23393932-23393954 TGGCCCCCAGAACCTCAAGAAGG + Intergenic
1182760547 22:32719113-32719135 TCCTCCCCAGGACCTCAAAGAGG - Intronic
1183507341 22:38216571-38216593 CCGCCACCAGAAGCCCTAAGGGG - Intergenic
1184405918 22:44300784-44300806 GTGCCCCCAGAACCCCAGATGGG + Intronic
959716587 3:109440345-109440367 TCTCCCCCAGAGCCTCAAAAAGG - Intergenic
961580419 3:127876150-127876172 CCTCCCCCAGAAGCCCAGAGAGG + Intergenic
961626681 3:128269041-128269063 TTGCCCCCAGAAGCCCAAGATGG - Intronic
964383855 3:156126490-156126512 TCGTCCCCATATCCCCAAGGAGG + Intronic
966931608 3:184679083-184679105 TCGCCCCCTAATCCACAAAGTGG + Intronic
967979715 3:195058559-195058581 CAGCCCCCAGAATCCCAGAGGGG - Intergenic
978062228 4:104352155-104352177 CTGCCCCTAGACCCCCAAAGAGG + Intergenic
986667762 5:10118072-10118094 AAGCCCCCATAACCCAAAAGTGG + Intergenic
988556298 5:32239003-32239025 TCTCCGCCAGAACGACAAAGAGG - Exonic
994148430 5:96420708-96420730 TCTCCCTCAGAACTCCCAAGTGG - Intronic
996481656 5:123982520-123982542 TCTCCCCCAGCACCCCCAACAGG + Intergenic
996791452 5:127297896-127297918 TAGCCCCAAGAATCCCATAGTGG - Intronic
1006611754 6:35298219-35298241 TGGCCCTCAGAACCCCATAATGG - Intronic
1007312679 6:40959123-40959145 TCTTCCCCAGAACCCCACAAAGG - Intergenic
1007653315 6:43436568-43436590 TCTCCCCCAGATCCCCAATCTGG - Intronic
1007748043 6:44055222-44055244 CCAGCCCCAGAACCCCACAGAGG + Intergenic
1008253101 6:49264930-49264952 GCCACCCCAGAGCCCCAAAGAGG + Intergenic
1010764692 6:79765439-79765461 GCAACCTCAGAACCCCAAAGAGG - Intergenic
1012548375 6:100446787-100446809 TTCCCCCCTGAACCACAAAGGGG - Intronic
1019005242 6:168791056-168791078 TCGTCACCAGTCCCCCAAAGTGG - Intergenic
1021920489 7:25480244-25480266 ACTCCCCCAGAACCCAAATGGGG - Intergenic
1022113858 7:27246518-27246540 TCGCCCCTAGGACGCCAAGGGGG + Exonic
1026671978 7:72398712-72398734 TGTCCCCCAGGACCCCTAAGAGG - Intronic
1035649580 8:1254727-1254749 TCGGCCCCCGAAACCCAAAAGGG - Intergenic
1038979960 8:32748871-32748893 TCTGCCCCAAAACCCCAAACAGG - Intronic
1050105879 9:2166250-2166272 TGGCGCCCAGAACTCCAATGGGG + Intronic
1050924197 9:11242043-11242065 TGACCCCCACAACCCCCAAGAGG - Intergenic
1052332221 9:27281641-27281663 TCTTCCCCAAAACCTCAAAGGGG - Intergenic
1053577170 9:39364580-39364602 TCACCCAGAGAACCCCACAGAGG + Intergenic
1053841672 9:42192505-42192527 TCACCCAGAGAACCCCACAGAGG + Intergenic
1054098741 9:60923270-60923292 TCACCCAGAGAACCCCACAGAGG + Intergenic
1054120141 9:61198899-61198921 TCACCCAGAGAACCCCACAGAGG + Intergenic
1054587615 9:66983663-66983685 TCACCCAGAGAACCCCACAGAGG - Intergenic
1061083712 9:128387107-128387129 GCTCCCCCAGAACCACAAGGAGG + Intronic
1061538043 9:131261473-131261495 CTGCCCCCAGAACGTCAAAGGGG - Intronic
1062023197 9:134328800-134328822 TCTACCCCAGACCCCAAAAGCGG - Intronic
1062398756 9:136363339-136363361 TCCCTCCCAGAAGCCCCAAGGGG + Intronic
1186514749 X:10158646-10158668 GCGCCCCCAGAAACCCAAAGTGG + Intronic
1189230753 X:39450754-39450776 CCGCGCACTGAACCCCAAAGTGG - Intergenic
1189380200 X:40497281-40497303 TAGCCCCCAGAAGCCGGAAGAGG + Intergenic