ID: 1088649408

View in Genome Browser
Species Human (GRCh38)
Location 11:111944146-111944168
Sequence CCTCATCTTCTGCTGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 8, 3: 34, 4: 335}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088649399_1088649408 17 Left 1088649399 11:111944106-111944128 CCTTGCTCTTAGTTTCTCAGCAA 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG 0: 1
1: 0
2: 8
3: 34
4: 335
1088649400_1088649408 -9 Left 1088649400 11:111944132-111944154 CCCCACCCTCATCTCCTCATCTT 0: 1
1: 1
2: 17
3: 177
4: 1096
Right 1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG 0: 1
1: 0
2: 8
3: 34
4: 335
1088649401_1088649408 -10 Left 1088649401 11:111944133-111944155 CCCACCCTCATCTCCTCATCTTC 0: 1
1: 0
2: 11
3: 91
4: 1045
Right 1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG 0: 1
1: 0
2: 8
3: 34
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088649408 Original CRISPR CCTCATCTTCTGCTGCTGGA GGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
902282096 1:15382177-15382199 CCTCACCTTCTGCTGCCGGATGG - Exonic
902476696 1:16692309-16692331 CCGCAGCTTCTCCTTCTGGAAGG - Intergenic
902635785 1:17734285-17734307 CCTCATCTTCTTCTGGAGAATGG - Intergenic
902821415 1:18945578-18945600 CCTGCTCATCTGCTGCTCGATGG - Intronic
903058107 1:20650658-20650680 CCTCCTCCTCTGCTCATGGAGGG + Exonic
904673213 1:32181221-32181243 CCTCATCCTCTCCTGCTGTAGGG + Exonic
904907872 1:33911780-33911802 CCTATTCTTCTGCAGGTGGAGGG + Intronic
906994933 1:50782296-50782318 CCACATCTTGTCCTACTGGAAGG - Intronic
907087666 1:51691852-51691874 CCACATCTTGTCCCGCTGGAAGG + Intronic
909505168 1:76379906-76379928 CCTCTTCCTCTGCTGCTCTATGG - Intronic
910217388 1:84855980-84856002 CCTCAGTGTCTGATGCTGGAAGG - Intronic
912539492 1:110402698-110402720 CCACATCTTCTCCCACTGGAAGG - Intronic
914943724 1:152045443-152045465 CCTCACCTCCTGCTCTTGGAAGG + Intronic
915111346 1:153566321-153566343 CCTCCTCTTCTCCAGCTTGAGGG + Intronic
915175200 1:154008767-154008789 CCACATCTTCTCCTGCTGTCAGG + Intronic
916947883 1:169747425-169747447 CATAATCTTTTGCTGGTGGAAGG + Intronic
917449942 1:175139491-175139513 CCGCATCTTGTCCCGCTGGAAGG + Intronic
918031479 1:180816978-180817000 CCACATCTTCTCCCACTGGAAGG - Intronic
918243512 1:182640317-182640339 CCTGATCTTTTGCTGAGGGATGG - Intergenic
918419563 1:184350720-184350742 CCTCCTCTCCTGCTGCTCTAGGG + Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
920153356 1:203927698-203927720 CCACATCTTGTCCTCCTGGAAGG + Intergenic
920165445 1:204032377-204032399 TCTCATCTTCTGTAGCTGTAGGG + Intergenic
920670412 1:207999841-207999863 CCTCATCCTCTGATGATGTAGGG - Intergenic
922538635 1:226402322-226402344 CCACTTCTCCTGCTTCTGGAAGG - Exonic
923217903 1:231866883-231866905 GCTCATCCTCTGCCGCAGGAGGG + Intronic
923674269 1:236065880-236065902 CCACATCCTCTGCTGGGGGATGG - Intergenic
1062802746 10:392220-392242 CATCAGCTTCTGCAGCAGGAAGG + Intronic
1062944509 10:1450330-1450352 CTTCGTTTCCTGCTGCTGGAAGG + Intronic
1064584501 10:16826115-16826137 CTTCATTTTCTGCAGCTGCAAGG + Intronic
1064908722 10:20377076-20377098 ACTCATCTTTTTCTGGTGGAGGG + Intergenic
1066583107 10:36901905-36901927 GTTCATTTTCTGCTGCAGGATGG + Intergenic
1067220874 10:44343430-44343452 TCTCATCTCCTGCTGATGGGGGG + Intergenic
1069126718 10:64643948-64643970 CATCATCTTTTGCTGGTGGAAGG - Intergenic
1069211215 10:65761886-65761908 CCTCATCTTGTCCCACTGGAAGG + Intergenic
1069572733 10:69504170-69504192 CCTGATCTGCTGCTAGTGGAGGG + Intronic
1069612186 10:69781578-69781600 CCTCATCCTCTGAGGCTGCAGGG + Intergenic
1069718169 10:70533972-70533994 CCTCGTCTTCAGCTGCCAGATGG + Exonic
1072437299 10:95425771-95425793 CCTCATCTTCTGAACTTGGAAGG + Intronic
1072724827 10:97806178-97806200 CCTCCTCATCTGCTGCTGCAGGG + Intergenic
1073070883 10:100792560-100792582 CCCCATCCTCTGCTTCTGGATGG - Intronic
1073817937 10:107228094-107228116 CCTCATCTTCTGTAGCTGAAGGG + Intergenic
1074112317 10:110431244-110431266 CCTCCTCTACTGCTGGTGGGAGG - Intergenic
1074243578 10:111664709-111664731 CCTGATCATCTGCTGCTGGAAGG - Intergenic
1074698019 10:116068288-116068310 GCTCAACCTCTGCTGCTGTAGGG - Intronic
1075734569 10:124655996-124656018 CCCCATTGCCTGCTGCTGGATGG - Intronic
1077167961 11:1152247-1152269 CCTCTCCTGATGCTGCTGGAGGG + Intergenic
1077421095 11:2450389-2450411 GCCCAACATCTGCTGCTGGAGGG + Intronic
1078351101 11:10594187-10594209 CCCCATCTTCTGCAGCAGGAGGG + Exonic
1078365645 11:10704280-10704302 CCCCAAGTTCTGCTGCTAGAGGG - Intergenic
1080244185 11:30161026-30161048 GGTTATCTTCTTCTGCTGGATGG - Intergenic
1080700304 11:34638792-34638814 CCCCATCTTCTGCTGGAGGCAGG - Intronic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1081694505 11:45100555-45100577 CATCATCTGCTGCTGCTGATTGG + Intronic
1081818113 11:45964470-45964492 CTGAATCTTCTGCTTCTGGATGG - Intronic
1082216631 11:49578367-49578389 CCTGATCTTCTGAAGCTAGAAGG - Intergenic
1082990491 11:59203493-59203515 CCATATCTTATCCTGCTGGAAGG + Intronic
1083488573 11:62998695-62998717 CCTCTTCTTCAGCTGCAGGCAGG + Intronic
1084982310 11:72836401-72836423 GCTCTGATTCTGCTGCTGGAGGG - Intronic
1085348549 11:75783676-75783698 CCACTTCTTCAGCTGCCGGAAGG + Intronic
1085703486 11:78765398-78765420 CCTCATCTCTTATTGCTGGAAGG - Intronic
1087114108 11:94505332-94505354 CCACATCTTGTCCTGCTGGGAGG - Intergenic
1087475495 11:98628635-98628657 CCACATCTTCTCCCACTGGAAGG + Intergenic
1087553379 11:99681472-99681494 GGTCATCTTTTGCTGCTGGTGGG - Intronic
1087728521 11:101751916-101751938 CCTCTTCTTCGTCTCCTGGATGG + Intronic
1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG + Intronic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1090260688 11:125316735-125316757 CATAATTTTTTGCTGCTGGAGGG + Intronic
1090474076 11:127003916-127003938 CCCCAGGTTCTGCTGCTGGCTGG + Intergenic
1091022962 11:132117426-132117448 GCTAAGCTTCTGCTGATGGAAGG + Intronic
1091628806 12:2142636-2142658 CCACATCTTGTGCCACTGGAAGG - Intronic
1091812749 12:3413512-3413534 CCTCATCTTGTCCCACTGGAAGG + Intronic
1091975527 12:4821727-4821749 CCTCAGCTTTTGCTGATGGTGGG - Intronic
1092045344 12:5428525-5428547 TTGCATCTTCTGCTGCTGGAGGG - Intergenic
1093923765 12:24889102-24889124 CCAGCTCATCTGCTGCTGGATGG + Intronic
1094502180 12:31031505-31031527 CCAGATCTGCTGCTGCAGGAGGG + Intergenic
1095852284 12:46823954-46823976 CCACCTCATCTGCTGCTGGGAGG - Intronic
1096370421 12:51064501-51064523 CCTCATCTGGGGCTGCTGGGCGG + Exonic
1097272493 12:57785336-57785358 TCACATCTTGTCCTGCTGGAAGG + Intronic
1097621054 12:61940308-61940330 CCACATTTTCAGCTCCTGGATGG + Intronic
1098361174 12:69655679-69655701 CTTCTTCTTCTGGGGCTGGAGGG + Exonic
1098391603 12:69975414-69975436 CCTCACATTCTGCTGCTCAATGG - Intergenic
1098745125 12:74227115-74227137 CCACATCTTGTCCTGCTGGAAGG - Intergenic
1098745134 12:74227204-74227226 CCACATCTTGTCCTGCTGGAAGG - Intergenic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1103444781 12:120987514-120987536 CCTCCTGTTCTGGTGCTGCAGGG + Intronic
1104899563 12:132181667-132181689 CGTCAGCCTCAGCTGCTGGAGGG + Intergenic
1105510257 13:21045832-21045854 TCTCATCTGCTGCTGCTGCCTGG + Exonic
1105776905 13:23670791-23670813 CCTCATTTAGTGCTGCTGGGAGG - Intronic
1107294749 13:38897113-38897135 CCACATCTTGTCCCGCTGGAAGG + Intergenic
1107540827 13:41387588-41387610 CCTCAATCTCTGCTCCTGGAGGG - Intergenic
1108678569 13:52759963-52759985 CCTCATCTTCTGCCTATTGAAGG + Intergenic
1109071762 13:57778659-57778681 CCTAAGCTTCTGCTGGTGGGTGG - Intergenic
1111134994 13:84029827-84029849 CATAATCTTTTGCTGGTGGAAGG + Intergenic
1111452850 13:88441545-88441567 CCTTATCTCCTGCAGCTGCAGGG + Intergenic
1111762597 13:92484206-92484228 CCACATCTTGTACTACTGGAGGG + Intronic
1112626953 13:101115913-101115935 CCTCAGCTTCTGCAACTGGGAGG + Intronic
1112942483 13:104881213-104881235 CCACATCTTGTCCTACTGGAAGG + Intergenic
1113329903 13:109317675-109317697 CCTTTTCTTTTGCTGCTGGGCGG + Intergenic
1113874203 13:113584595-113584617 CCTCCTCTTCTGCTGCTCCTCGG - Intergenic
1114973328 14:28061901-28061923 TTTCTTCTTCTGCTGCTGGATGG + Intergenic
1116693903 14:48148115-48148137 CCTCAACATCTGCTTTTGGATGG - Intergenic
1116846447 14:49868492-49868514 AGTCATCTACTGCTGCTGGCAGG + Intergenic
1117123073 14:52590102-52590124 CCACATCTTGTGCCACTGGAAGG - Intronic
1117344155 14:54816632-54816654 CCATATCTTGTTCTGCTGGAAGG - Intergenic
1118064910 14:62180249-62180271 CCTTGTCTTCTGAAGCTGGATGG + Intergenic
1119854251 14:77887352-77887374 CCTCTCCCTCTGCTGCTTGAAGG - Intronic
1120975782 14:90247049-90247071 CCTCTTCTTGTTCTCCTGGAAGG - Intergenic
1121836278 14:97095458-97095480 CCTCGTCTCCACCTGCTGGATGG + Intergenic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1122634869 14:103125062-103125084 CCTCAGTTTCTCCTTCTGGATGG + Intronic
1123907099 15:24932063-24932085 CCCTATCTTCTGCTGTTGGCTGG + Intronic
1127504263 15:59582759-59582781 CTTGATCTTGTGCTGCTGCAGGG + Intergenic
1130780648 15:87036043-87036065 CCTCATTTCCTGATTCTGGAGGG + Intergenic
1130871397 15:87974922-87974944 GCACATCTTCTGCTCCTGGAAGG - Intronic
1131057964 15:89387294-89387316 CCTCAGCAGCTGCTGCTGGTGGG + Intergenic
1132678077 16:1128909-1128931 TCTCATCTGCTGCTGCTGCGTGG - Intergenic
1133287859 16:4698794-4698816 ACTCACCTTGTGCAGCTGGATGG + Exonic
1135475079 16:22766950-22766972 GATCATCTTCTGCTGTTTGAAGG + Intergenic
1137620198 16:49871229-49871251 CCACATTTTCTGCTTCTGGGAGG - Intergenic
1137723160 16:50639596-50639618 CCTCATCCTCTGCTGCAGCATGG - Exonic
1141751354 16:85960573-85960595 CCTGAACTTCTGCTTCAGGATGG + Intergenic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1146260372 17:31416669-31416691 CCCCTTCTCCTGCTGCTGCAGGG - Intronic
1147213545 17:38886198-38886220 CCTCATCTTCAGCTCCAGGCAGG - Intronic
1147552853 17:41456892-41456914 CATCATCTTCTGTGTCTGGATGG - Intergenic
1148779607 17:50113937-50113959 CCGCAGCTGCTGCAGCTGGACGG - Exonic
1150824908 17:68465846-68465868 CATCCTCTACTGCTGCTGTAGGG - Intergenic
1150957732 17:69879661-69879683 CATTATCTTCTAATGCTGGAAGG + Intergenic
1152779252 17:82219168-82219190 CCTCCTCTTCTGCAGCTTGGGGG - Intergenic
1155740974 18:29287170-29287192 TTTCATCTCCTGCAGCTGGAGGG - Intergenic
1155877502 18:31104635-31104657 ACTCATCCTCTGGTGCTGGCAGG - Intergenic
1156008356 18:32470118-32470140 CCTCCTTGTCTGCTGCTGGGGGG + Intronic
1156482920 18:37447504-37447526 CTTCCTCTCCTGCAGCTGGAGGG + Intronic
1156798928 18:41084525-41084547 TCTCATCTTCTGTTTCTGAAAGG + Intergenic
1157599846 18:48887204-48887226 CTGCATCTGCTGCTGCTGGCAGG + Intergenic
1157807210 18:50667021-50667043 CCTCTTCCTCTCCTGATGGAGGG + Intronic
1159308965 18:66683156-66683178 CCTCTTCCTCTGCTGCTGCCTGG - Intergenic
1160247232 18:77168758-77168780 CCTCATTTCGTGCTCCTGGAAGG + Intergenic
1160546302 18:79658457-79658479 CCAAATCTCTTGCTGCTGGAGGG + Intergenic
1161074116 19:2276625-2276647 ACTGACCTCCTGCTGCTGGAGGG - Intronic
1162333678 19:10046722-10046744 CCTCTTCTTCATCCGCTGGAGGG - Intergenic
1163382366 19:16977514-16977536 CCTCAGCTTCTGGGGCTGGTGGG + Exonic
1164406946 19:27957580-27957602 CCTCCTCCTTTGATGCTGGAAGG - Intergenic
1164452677 19:28380616-28380638 CCCCACCTTCTTCTTCTGGATGG + Intergenic
1164999384 19:32748584-32748606 CCTCAGCTTCTGCTGCTGGCGGG + Intronic
1165269029 19:34688849-34688871 CCTTATCTTCAGGTGCTGGCTGG + Intergenic
1165735047 19:38170454-38170476 CCCCAGCCTCTGCTCCTGGAAGG + Intronic
1166656739 19:44617889-44617911 CCTTACCTTTTGCTGCTGGTTGG - Intronic
1167473480 19:49687739-49687761 TCTCATCTTCATGTGCTGGAGGG + Intronic
1202710717 1_KI270714v1_random:18150-18172 CCGCAGCTTCTCCTTCTGGAAGG - Intergenic
926248188 2:11136561-11136583 CCTCATCCTCCCCTTCTGGATGG - Intronic
926664277 2:15503108-15503130 CCACATCTTATCCCGCTGGAAGG + Intronic
927000984 2:18793914-18793936 CCTCATCTACCACTGCAGGAAGG + Intergenic
929153601 2:38770110-38770132 CCCCATCTTCCGCTGCAGAAAGG + Intronic
930725896 2:54681037-54681059 CCTCATATTCTGCAGAAGGAAGG + Intergenic
930953571 2:57175729-57175751 CTTTATTTTCTGCAGCTGGAAGG - Intergenic
932054894 2:68433552-68433574 CCTCATCCACTGCTGCTACAGGG - Intergenic
932116900 2:69059391-69059413 CATAATCTTTTGCTGGTGGAGGG - Intronic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932592418 2:73075367-73075389 CCTCAACTGGGGCTGCTGGAAGG - Exonic
936339663 2:111619746-111619768 CCACATCTTGTGCTGCTGGAGGG - Intergenic
937004156 2:118496175-118496197 CCCCACCCTCTGCTGCTGGGCGG + Intergenic
937066540 2:119022291-119022313 CCTTACCTTCTGCTGCTCTAAGG - Intergenic
940477260 2:154178689-154178711 CCTCATCATTTGCTGCCTGAGGG + Intronic
942459653 2:176160244-176160266 CCTCAGCCTCTGCTGCTCCACGG + Intronic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
943346183 2:186739592-186739614 CCACATCTTGTCCTACTGGAAGG + Intronic
944763530 2:202841388-202841410 CATCTTCTGCTGCTGCAGGAGGG + Intronic
944867826 2:203879947-203879969 CCTCAGCTTCTGCTCCAGGCTGG - Intergenic
947905719 2:233760424-233760446 CCTCTGCTGCAGCTGCTGGATGG - Exonic
947922946 2:233894080-233894102 CTTCATCTTCTGCAGGAGGAAGG + Intergenic
947992032 2:234496011-234496033 CCGCTTCTTCTTCTGCTTGAGGG + Exonic
948831511 2:240600614-240600636 CCACAGCCACTGCTGCTGGAGGG - Intronic
1168813671 20:722347-722369 CCTCATTATCTGATGCTGCACGG - Intergenic
1169070907 20:2729807-2729829 CCTCAGGTTCTGCTTCTAGAGGG - Intronic
1169906661 20:10611525-10611547 CCTCACCTCCCCCTGCTGGAAGG - Intronic
1170120338 20:12904766-12904788 CCTCATTTTGTCCTGCTGGAAGG - Intergenic
1170210713 20:13844026-13844048 CCTAGGGTTCTGCTGCTGGATGG - Intergenic
1170569639 20:17625518-17625540 CTTCACTTTCTGCTGCTCGACGG + Exonic
1172535396 20:35669232-35669254 CTTCGTCTTCTGCTGCTGCTCGG - Exonic
1174422885 20:50411781-50411803 ACTCATTTTCAGCTGCTGGAGGG - Intergenic
1175327381 20:58139149-58139171 CCTGAGCTCCTGCTGCTGCATGG - Intergenic
1177095082 21:16822765-16822787 CCTAATCTCCTGTAGCTGGAAGG + Intergenic
1177599758 21:23295414-23295436 CCTCATCTTCTTCTGCTTGGAGG + Intergenic
1178107755 21:29339226-29339248 ACACATATACTGCTGCTGGAAGG - Intronic
1178226252 21:30722596-30722618 CCTCATCTTCTGAGACTGAAGGG - Intergenic
1178853511 21:36232437-36232459 CTTCAGCTTCTGGTGCTGGCCGG + Intronic
1179066409 21:38028739-38028761 CCTCTTCTTCTTCTTCTAGATGG - Intronic
1179779497 21:43690310-43690332 CCTCAGCTTCTGCTTCTTCAGGG - Exonic
1179881326 21:44294383-44294405 CCTCATCCTCTGCTGCAGGACGG + Exonic
1181173580 22:21023585-21023607 GCTCTTCTCCTGCAGCTGGAAGG - Exonic
1181324266 22:22032666-22032688 CCTCACCCTGAGCTGCTGGAGGG + Intergenic
1181412071 22:22731038-22731060 GCTCATCAGCTGGTGCTGGAAGG + Intergenic
1181940369 22:26471143-26471165 CCTCCTCTTCTGCTGCCGTGAGG - Intronic
1182998066 22:34832606-34832628 CCACAGGTTCTGCTGCAGGAAGG + Intergenic
1183029528 22:35093235-35093257 CTGCCTCTTCTGGTGCTGGAGGG + Intergenic
1183191779 22:36326252-36326274 CCTCCCCTTCTGAGGCTGGAAGG - Intronic
1183338048 22:37262210-37262232 CACCATCTGCTGCTGCTGGGTGG - Intergenic
1183593056 22:38792693-38792715 CCACATCTTGTCCCGCTGGACGG + Intronic
1183861383 22:40672865-40672887 CCTCATCTTCTGCAGCAATAAGG + Intergenic
1183978276 22:41525586-41525608 TCTGATCAGCTGCTGCTGGATGG - Intronic
1184382892 22:44157244-44157266 CATCAGCATCAGCTGCTGGAAGG - Intronic
1184384479 22:44166518-44166540 CCTACTCATCTGCCGCTGGACGG + Intronic
1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG + Intronic
1184594511 22:45505574-45505596 ACTCATCTTCAGGTCCTGGAGGG + Intronic
1185039991 22:48498926-48498948 TCTCCACTTCTGCAGCTGGACGG + Intronic
1185095260 22:48802916-48802938 CCTCATGCTCTGCTCCTAGACGG + Intronic
949255748 3:2043922-2043944 CCACATCTTGTCCTACTGGAAGG + Intergenic
949750175 3:7343160-7343182 TATCATCTTCTGCTGCTAAAGGG - Intronic
950105405 3:10385313-10385335 CCGCACCGTCTGCTGCTGCAGGG + Exonic
950161778 3:10765791-10765813 TCTCAGGCTCTGCTGCTGGAAGG - Intergenic
951742792 3:25942797-25942819 TCTCATCTACTGCTGGTGGGAGG - Intergenic
952114281 3:30160388-30160410 CCACATCTTCTTCCACTGGAAGG - Intergenic
952387811 3:32855529-32855551 CCTCCTCTTTTGCTGCTACATGG + Intronic
952735243 3:36683191-36683213 TATATTCTTCTGCTGCTGGATGG - Intergenic
952988541 3:38810439-38810461 CCTCAAATTCTGCTTCTAGATGG + Intergenic
953445844 3:42965615-42965637 CATAATCTTTTGCTGGTGGAAGG - Intronic
953495986 3:43387387-43387409 CCTCATCTTGGGGTGCTGGGCGG + Intronic
954767688 3:52934814-52934836 CCTCCTGTTCCGCTGCTAGAGGG - Exonic
958761543 3:98315024-98315046 CCACATCTTGTGCCACTGGAAGG - Intergenic
962140155 3:132781832-132781854 ACTCATCTTCTGCTTCTTGAAGG + Intergenic
962267807 3:133955826-133955848 CCAGAACTTCTGATGCTGGAGGG + Intronic
962318145 3:134371314-134371336 CCTCAGGGCCTGCTGCTGGATGG + Exonic
962985244 3:140530614-140530636 CCACATCTGCTGAAGCTGGATGG - Intronic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
966855238 3:184189256-184189278 CCAGATCTTCTGCTGTTAGATGG + Exonic
967250983 3:187537854-187537876 CCACATCTTGTCCCGCTGGAAGG + Intergenic
967778405 3:193408544-193408566 TCAGATCTTCTGCTGCTGGGAGG + Intronic
967984464 3:195084932-195084954 CCTCAGCTTCTGCAACTGGCAGG - Intronic
968044267 3:195614974-195614996 CCTTTTCTTCTTCTGCTGGGAGG + Intergenic
968060055 3:195721037-195721059 CCTTTTCTTCTTCTGCTGGGAGG + Exonic
968431338 4:560931-560953 CCACACATGCTGCTGCTGGAAGG - Intergenic
968577987 4:1376808-1376830 CCTCAGCTCCTGCCGCAGGACGG + Intronic
970376862 4:15467554-15467576 CCTCATCTGCTGCTGCCCAAAGG - Intergenic
970418991 4:15887411-15887433 CTTTACCTTCTTCTGCTGGAAGG + Intergenic
970841638 4:20478446-20478468 TCTCAACTTCTGCTCCTGTAAGG + Intronic
970889048 4:21021670-21021692 CCACATCTTGTCCTGCTGGAAGG + Intronic
972375421 4:38465210-38465232 CCTCCTCCTCTGCGGCTGAAAGG + Intergenic
974237540 4:59201020-59201042 CCTCTTCTCTTGCTTCTGGATGG + Intergenic
974506613 4:62782178-62782200 CCTCTTCTTCTTCTTCTGGAAGG + Intergenic
974683639 4:65195722-65195744 CCTCACCCACTGCTGCTGCAGGG - Intergenic
975801491 4:78063248-78063270 CCTCAACTTCATCTGCTGGTGGG + Intronic
977255105 4:94731973-94731995 GTTCATCTTCTGCAGCTAGAGGG - Intergenic
977292910 4:95182455-95182477 CCTAATCACCTGCTGCTGGGTGG - Intronic
978182447 4:105815224-105815246 CCTCCTCTGCTGATGCTGTATGG - Intronic
981451510 4:144903503-144903525 CCTTGTCTCCTGGTGCTGGAGGG + Intergenic
981914615 4:150020610-150020632 CCACATCTTGTCCCGCTGGAAGG + Intergenic
982277305 4:153649586-153649608 CCACATCTTATCCTGCTCGAAGG + Intergenic
984264592 4:177482132-177482154 CCACATCTTGTCCTACTGGAAGG - Intergenic
984527600 4:180875681-180875703 CCTTTTCTTCTGCAGCTGGGAGG - Intergenic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
988253198 5:28787235-28787257 TCTCATCTTTTGCTGCTGCCTGG - Intergenic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
991919185 5:71637519-71637541 AATCATCTTTTGCTGGTGGAGGG + Intronic
992057951 5:73011568-73011590 CCACATCTTGTACTACTGGAAGG + Intronic
992503908 5:77366960-77366982 CATCAGCTTCTGCCTCTGGAGGG - Intronic
992901782 5:81303529-81303551 CCACATCTTGTCCTACTGGAAGG + Exonic
994996507 5:107070486-107070508 CCTAATCTTTTGCTGGTGGAGGG + Intergenic
996225758 5:120993976-120993998 CCACATCTTCTCCCACTGGAAGG + Intergenic
997362386 5:133303377-133303399 CCTCATCTGCTGCTTCAGGCAGG + Intronic
997755622 5:136396390-136396412 CATCATCTGCTGTTGGTGGATGG - Intronic
997895721 5:137715105-137715127 CCACAGCTGCTGCTTCTGGATGG - Intronic
998345494 5:141458462-141458484 CCTCATTTTCTGCAGTTGTACGG - Intronic
998563765 5:143197325-143197347 ACTCATATTTTGCTGCAGGAGGG - Intronic
998937268 5:147242376-147242398 CCCCATGTTCTGATGATGGAAGG + Intronic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
999748827 5:154611123-154611145 CCTCACCGTCAGCTCCTGGAGGG + Intergenic
999963253 5:156779734-156779756 CCTCATTACCTGCTCCTGGAAGG + Intergenic
1000308554 5:160018955-160018977 CCTTGTCTTCAGCTACTGGATGG + Intronic
1001073674 5:168607836-168607858 CCTCATCGCCTGCAGCTAGAGGG - Intergenic
1001086272 5:168701995-168702017 GCCCATCTTCAGCAGCTGGAAGG + Intronic
1001524639 5:172419803-172419825 CCTCCTCTTCTGCTCCTTGGAGG + Intronic
1002138384 5:177122705-177122727 CCTCAACCTCTGATACTGGAGGG - Intergenic
1002182140 5:177436166-177436188 CTTCTTCTTCCTCTGCTGGAAGG - Exonic
1002972630 6:2039683-2039705 CCACGTCTTCTCCTGCTGGAAGG + Intronic
1003071298 6:2947481-2947503 CCTGTCCTTCTGCTCCTGGATGG + Intergenic
1003878614 6:10460536-10460558 GCTCATCCTTTGCTGCTGCATGG + Intergenic
1003945088 6:11067862-11067884 CCTGAGCTTCTGCTGCTGACAGG - Intergenic
1004839460 6:19566358-19566380 CCTCATGTCCTCCTGCTGCATGG - Intergenic
1005308693 6:24538564-24538586 CCTCATCTTGCCCCGCTGGAAGG + Intergenic
1005873105 6:29991951-29991973 CCACTTCTTCTGATGCTGTATGG - Intergenic
1006027191 6:31154667-31154689 CCTCATCTTCTGCTGCAGCGAGG + Exonic
1007606378 6:43120967-43120989 CATCTTCTTCTGGGGCTGGAAGG - Intronic
1011934630 6:92759959-92759981 CAACATCTTGTCCTGCTGGAAGG - Intergenic
1012225799 6:96702051-96702073 CCTTATCTTCTGTAGCTGCAGGG + Intergenic
1013566636 6:111371105-111371127 CATCCTCTTCTGCTTCTGAATGG + Intronic
1014249289 6:119099273-119099295 CCTCATCTTTAGCTTCTGCAGGG + Intronic
1014579419 6:123118054-123118076 CCACATCTTGTGCCACTGGAAGG - Intergenic
1014603848 6:123448301-123448323 CCTTTTCTTTTGCAGCTGGAAGG + Intronic
1014787876 6:125638803-125638825 CCTAATCTCTTGCAGCTGGAGGG - Intergenic
1015110936 6:129590576-129590598 CCTCATCCTCTGCTCATTGAGGG - Intronic
1015721177 6:136243837-136243859 CCACATCTTGTCCTACTGGAAGG - Intronic
1015781171 6:136867388-136867410 TCACATCTTGTCCTGCTGGAAGG - Intronic
1017002034 6:150003789-150003811 CCCCATCCTTTGCTGCTGGGTGG - Intergenic
1017052751 6:150408750-150408772 GCCCATCTTCTGCTCTTGGAAGG + Intergenic
1018360589 6:163063344-163063366 CCTCATCTTCCACTCCAGGATGG + Intronic
1018360636 6:163063817-163063839 CCTCATCCACAGCTGCAGGAAGG + Intronic
1019261754 7:85908-85930 CTTCATCATATGCTCCTGGAAGG + Intergenic
1019496754 7:1344339-1344361 CCGCAGCTTCTGCTTCTGGGAGG + Intergenic
1019536680 7:1533124-1533146 CCTCATCTACAGCAGCTGGTCGG - Intronic
1019884503 7:3892380-3892402 CCTGCTCTTCTCATGCTGGAGGG + Intronic
1020560877 7:9727794-9727816 CCTCAGCTTCTGGGGCTGGTGGG - Intergenic
1021924033 7:25517883-25517905 CTTCACCTTCTGCTACTGGGTGG + Intergenic
1021933964 7:25611557-25611579 CGTCATCTTTTGCTGGTGGAGGG + Intergenic
1022220871 7:28312282-28312304 CCTCTTTTTCTGCTCATGGATGG + Intronic
1023216879 7:37872016-37872038 CCTCATCTTCTCCTGCCCTAGGG - Intronic
1023308694 7:38858993-38859015 CCACATTTTGTCCTGCTGGAAGG - Intronic
1023596264 7:41831987-41832009 CCTCTTCTTCCTCTGCCGGAAGG + Intergenic
1024499987 7:50094466-50094488 TCTACTTTTCTGCTGCTGGAAGG + Intronic
1024594136 7:50917897-50917919 TCTCATCGTTTGCTGCTGCAGGG + Intergenic
1025027942 7:55533615-55533637 CCTCAGCTTCTTCAGATGGAAGG + Intronic
1027382012 7:77621216-77621238 CCATATCTTGTCCTGCTGGAAGG + Intronic
1027596331 7:80178548-80178570 CATCATCTTCTGCTGGAGAAGGG - Intronic
1027729047 7:81846257-81846279 CCTCACTTTCTGCTGATGGGAGG - Intergenic
1027892851 7:83998890-83998912 CCACATCTTGTCCTACTGGAAGG + Intronic
1027937568 7:84629702-84629724 CCACATCTTTTCCTACTGGAAGG - Intergenic
1028168262 7:87564356-87564378 CCCCTGCTTCTGCTGCTTGAGGG + Intronic
1030110985 7:106026813-106026835 CTGCATCTTCTGTGGCTGGAAGG + Intronic
1032492435 7:132333569-132333591 CCTGCTCCTCAGCTGCTGGAGGG + Intronic
1032739530 7:134724842-134724864 CCTCCTCTTCTGAGGTTGGATGG + Intergenic
1033659768 7:143395333-143395355 CCGCATATTCTGCATCTGGAAGG - Exonic
1034164522 7:149015101-149015123 CCTCCTCATCTGCTTCTGGAGGG - Intronic
1034902266 7:154914915-154914937 CCTCATCTTCTCTTCTTGGAAGG + Intergenic
1037694424 8:21210946-21210968 CCTCCTGTTCTGCTGCCGGAGGG + Intergenic
1038868676 8:31468435-31468457 CCACATCTTGTCCTGCTGGACGG - Intergenic
1038922889 8:32104783-32104805 CCACATCTTGTCCTACTGGAAGG + Intronic
1039496208 8:37982400-37982422 CCACATCTTGTCCTACTGGAAGG - Intergenic
1039645074 8:39273036-39273058 CCACATCTTGTCCTGCTGGGAGG + Intronic
1039800655 8:40951844-40951866 CAGCATCTTCTGCTGCTGCCTGG - Intergenic
1039921350 8:41896406-41896428 CTTCTCCTTCTGCTCCTGGAGGG + Exonic
1040909141 8:52501001-52501023 CCGCAGCTTCAGCTCCTGGAAGG - Intergenic
1041426953 8:57732393-57732415 CCACATCTTGTCCTGCTGTAAGG + Intergenic
1042089539 8:65143855-65143877 TTTCATCTTCTGTTCCTGGAAGG + Intergenic
1042187754 8:66154100-66154122 CCGCAGTTTCTGCTGCTGCAGGG - Exonic
1042310744 8:67377142-67377164 CCACATCTTGTCCTACTGGAAGG + Intergenic
1042669668 8:71247248-71247270 CCTCCTCTAGGGCTGCTGGAAGG - Intronic
1042867911 8:73371766-73371788 CCTCATCTTCAGCTGCCAGCTGG + Intergenic
1043083576 8:75798075-75798097 CTCCATCTGCTGTTGCTGGAAGG - Intergenic
1043491861 8:80757217-80757239 CCACATCTTGTTCTACTGGAAGG - Intronic
1043909521 8:85845176-85845198 CCACATCTTGTCCTCCTGGAAGG - Intergenic
1044684805 8:94816546-94816568 CCTCAGCTTCTTCAGCTGTAAGG + Intronic
1044732066 8:95237001-95237023 CCTCAGCCTCTGGTGGTGGAAGG - Intergenic
1045066289 8:98449110-98449132 TCTCTTCTTCTTCTTCTGGAAGG - Intronic
1045809248 8:106202015-106202037 ACTAATCTTCTGCAGCAGGAGGG - Intergenic
1046454307 8:114438734-114438756 AATGATCTTCTGCTGCTTGATGG + Intergenic
1048402356 8:134083703-134083725 CCTCCTCTGCTGCTGCTGTGTGG + Intergenic
1048707097 8:137165983-137166005 TCTCATCTCCTGCAGCTGTATGG + Intergenic
1048932478 8:139326091-139326113 TCTCATCTTCTGCAGCAGGAGGG + Intergenic
1049341305 8:142114004-142114026 CCTCGTCTGCTGATGCTGCAGGG + Intergenic
1049668693 8:143860117-143860139 GCTCATCTTCTCCTGGTGGCCGG + Exonic
1050479286 9:6073319-6073341 CTTCGTCTTCTGCTGGTTGATGG - Intergenic
1052543156 9:29837081-29837103 CCTAATTTTTTGCTGGTGGAGGG + Intergenic
1052616337 9:30846668-30846690 AGTCATCTTCTTCTGCTGCAGGG - Intergenic
1055287829 9:74748489-74748511 CCTCATCTTGTCCCACTGGAAGG - Intronic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1055464873 9:76554830-76554852 CCACATCTTATCCCGCTGGAAGG + Intergenic
1056443950 9:86646515-86646537 CCACATCTTCTCCCACTGGAAGG - Intergenic
1056808537 9:89746510-89746532 GCGCCTCTCCTGCTGCTGGAGGG + Intergenic
1057083300 9:92188543-92188565 CCTCATCGACTCCTGCTGGCTGG - Intergenic
1059649779 9:116305229-116305251 CCTCATTCTCTGTTGTTGGAAGG - Intronic
1061513083 9:131072642-131072664 GCTCATCATCTGCTCCAGGAAGG - Exonic
1061546641 9:131308409-131308431 CCTCATCTTCCCCTCCTGGCTGG + Exonic
1061709242 9:132476336-132476358 CCTCCTCTTGTGGGGCTGGATGG + Intronic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1061912612 9:133733042-133733064 TCTCACATTCAGCTGCTGGAGGG - Intronic
1186120145 X:6351631-6351653 CCTCTGCTTCTGCTCCTGGAGGG + Intergenic
1188221946 X:27551329-27551351 CATAATCTTTTGCTGGTGGAAGG - Intergenic
1195143744 X:101991557-101991579 CCACATCTTGTGCCACTGGAAGG + Intergenic
1197047258 X:122012454-122012476 CCTCATCTTGTCCCACTGGAAGG - Intergenic
1198375809 X:136038847-136038869 CTTCATCTTCTGGTACTGAATGG - Intronic
1199198177 X:145057015-145057037 TCTCATCTCCTGCAGCTGAAGGG + Intergenic
1200323962 X:155217894-155217916 CCTCATGCTCTGCTACTGGGAGG + Intronic
1200887272 Y:8281982-8282004 CCTGAGCTTCTGCAGCTGGTTGG + Intergenic
1200924728 Y:8644243-8644265 TTTCATTGTCTGCTGCTGGATGG + Intergenic
1201477861 Y:14403440-14403462 CCTCCACTTCTGCTCTTGGAGGG - Intergenic