ID: 1088651857

View in Genome Browser
Species Human (GRCh38)
Location 11:111964623-111964645
Sequence CATCCCGGAGATCTTGTCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088651857_1088651866 25 Left 1088651857 11:111964623-111964645 CCTGCGACAAGATCTCCGGGATG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1088651866 11:111964671-111964693 GATTGTTGGTCAGTTGGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 115
1088651857_1088651865 19 Left 1088651857 11:111964623-111964645 CCTGCGACAAGATCTCCGGGATG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1088651865 11:111964665-111964687 CATCGAGATTGTTGGTCAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 52
1088651857_1088651864 11 Left 1088651857 11:111964623-111964645 CCTGCGACAAGATCTCCGGGATG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1088651864 11:111964657-111964679 GCATATCTCATCGAGATTGTTGG 0: 1
1: 0
2: 0
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088651857 Original CRISPR CATCCCGGAGATCTTGTCGC AGG (reversed) Exonic
900359858 1:2283279-2283301 CAGCACGGAGCTCTTGTTGCTGG + Intronic
923889532 1:238197090-238197112 TATCCCTGAGCTCTTGTTGCAGG - Intergenic
1083635332 11:64117704-64117726 CATCACGGAGACCTTGGTGCAGG + Exonic
1088651857 11:111964623-111964645 CATCCCGGAGATCTTGTCGCAGG - Exonic
1092191864 12:6527006-6527028 CTTCCCGGAGAACTCGGCGCCGG - Exonic
1120853799 14:89195589-89195611 CCTCCTGGAGATCTTGTCCTGGG - Intronic
1124345983 15:28922033-28922055 CACCTCGGAGATCCTGTCCCTGG + Intronic
1129242804 15:74261562-74261584 CATCCCAGAGATCCTGTAGCAGG - Intronic
1141504073 16:84463194-84463216 CATCCCAGGGAACATGTCGCTGG + Intronic
1153591354 18:6676606-6676628 CATCCAGGAGACCTTGCTGCAGG + Intergenic
1160979528 19:1810637-1810659 CATCTTGGAGATCTTCTCTCTGG + Exonic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1166693201 19:44836712-44836734 CAGCTCAGAGATCTTGTCCCTGG + Intergenic
931994188 2:67824081-67824103 CATCCCGCAAATCTTTTCTCAGG + Intergenic
942654017 2:178195396-178195418 CTGCCCGCAGATCGTGTCGCCGG + Intronic
948827005 2:240577718-240577740 CATCCAGCAGATCCTGTCCCAGG + Exonic
1172515212 20:35528517-35528539 CATCCAGGAGCCCTGGTCGCTGG + Exonic
1176195003 20:63832662-63832684 CATCCCGGCGACCTTGGCGAGGG - Intergenic
1184587070 22:45455164-45455186 CACCTCGGAGAGCTGGTCGCTGG + Intergenic
1185057775 22:48589950-48589972 CAAGCCGAAGATCTTGTCACAGG + Intronic
985912942 5:2897307-2897329 CATCTCTGGGATCTTGTCACTGG - Intergenic
1001577796 5:172775451-172775473 CTTCCTGGAGTTCTTCTCGCTGG + Intergenic
1007157586 6:39760714-39760736 CATCCCGGTTATCTAGTGGCTGG - Intergenic
1194468160 X:94257750-94257772 CAGGCCTGAGATCTTGTCCCAGG - Intergenic
1197870685 X:131059650-131059672 CTTCTCAGAGATCTTGTTGCTGG - Intronic
1197935395 X:131735203-131735225 AATCCCAGAGATCTTGGCCCTGG + Intergenic
1198302286 X:135344344-135344366 CATCCTGGAGATTTTGACTCCGG - Intergenic