ID: 1088653202

View in Genome Browser
Species Human (GRCh38)
Location 11:111976614-111976636
Sequence GAGCCACTAAGTGGGCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088653202_1088653208 14 Left 1088653202 11:111976614-111976636 CCAGGGAGCCCACTTAGTGGCTC 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1088653208 11:111976651-111976673 AGCCCAGGAGCCCCCAGATGTGG 0: 1
1: 0
2: 4
3: 40
4: 358
1088653202_1088653205 -1 Left 1088653202 11:111976614-111976636 CCAGGGAGCCCACTTAGTGGCTC 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1088653205 11:111976636-111976658 CTGTGACCCATGAAGAGCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1088653202_1088653216 28 Left 1088653202 11:111976614-111976636 CCAGGGAGCCCACTTAGTGGCTC 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1088653216 11:111976665-111976687 CAGATGTGGCTTGCTCAGGACGG 0: 1
1: 0
2: 0
3: 19
4: 215
1088653202_1088653217 29 Left 1088653202 11:111976614-111976636 CCAGGGAGCCCACTTAGTGGCTC 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1088653217 11:111976666-111976688 AGATGTGGCTTGCTCAGGACGGG 0: 1
1: 0
2: 0
3: 12
4: 161
1088653202_1088653212 24 Left 1088653202 11:111976614-111976636 CCAGGGAGCCCACTTAGTGGCTC 0: 1
1: 0
2: 0
3: 15
4: 112
Right 1088653212 11:111976661-111976683 CCCCCAGATGTGGCTTGCTCAGG 0: 1
1: 1
2: 1
3: 18
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088653202 Original CRISPR GAGCCACTAAGTGGGCTCCC TGG (reversed) Intronic
900089117 1:911674-911696 GAGCCACTGAGTGGGGTGCAGGG + Intergenic
900096542 1:942274-942296 GAGCCTCCACGCGGGCTCCCAGG - Intronic
902623820 1:17665351-17665373 GAGACACTAAGTGGAGTCCTGGG + Intronic
904986050 1:34549699-34549721 GAGCTATGATGTGGGCTCCCAGG - Intergenic
906294987 1:44644226-44644248 GAGCCACAGAGTGGGACCCCCGG - Intronic
908796291 1:67833557-67833579 GGGCCACAACGCGGGCTCCCCGG - Intergenic
912643946 1:111373089-111373111 GGACCACCAAGTGGGCTCCTGGG + Intergenic
916366585 1:164035652-164035674 CAGCCACAAAGTGGCCTCCTGGG - Intergenic
1063098351 10:2927997-2928019 GCCCCACTGAGTGGGGTCCCTGG + Intergenic
1066754427 10:38696472-38696494 GAGCCACTCAGTGCCCACCCTGG + Intergenic
1067318744 10:45198179-45198201 GATCCACAAAGTTGTCTCCCTGG - Intergenic
1067809022 10:49412739-49412761 GAGACACAAAGTGGACTTCCAGG - Intergenic
1067904905 10:50280642-50280664 TAGCTACTAATTGGGCTCCAAGG + Intergenic
1069775621 10:70925615-70925637 CAGTCACCAAGTGGGCCCCCAGG - Intergenic
1070281323 10:75050973-75050995 GATTCACCAAGTGGGCTGCCTGG - Intronic
1071956550 10:90767011-90767033 GGGCCACTGGCTGGGCTCCCTGG + Intronic
1074138098 10:110644695-110644717 AAGCCACAAAGGGGGCTCTCGGG - Intronic
1075728858 10:124624589-124624611 CAGGCACCAAGTGTGCTCCCAGG + Intronic
1080795636 11:35560409-35560431 GGTCCTCTAACTGGGCTCCCTGG - Intergenic
1086998101 11:93382710-93382732 AAGGCACTATGTGGGCTCCCTGG - Intronic
1088653202 11:111976614-111976636 GAGCCACTAAGTGGGCTCCCTGG - Intronic
1090247150 11:125224606-125224628 TAGCCACTAATTTGGCTCCTGGG - Intronic
1090650425 11:128801300-128801322 GAGCCACTGGGTCAGCTCCCTGG + Intronic
1090683750 11:129091296-129091318 GAGCCCCTAAGGGAGCACCCAGG - Intronic
1092727161 12:11497772-11497794 GAGGCACAGAGTGGGCTTCCAGG - Intronic
1092900581 12:13055921-13055943 GAGCCGCCACTTGGGCTCCCAGG + Exonic
1103887555 12:124214298-124214320 GAGGCTCTTAGTGGCCTCCCTGG + Intronic
1104655588 12:130571862-130571884 CAGCCCCGAGGTGGGCTCCCTGG - Intronic
1104676159 12:130713926-130713948 GATCCTCAAAGTGGGGTCCCTGG + Intronic
1113349506 13:109514304-109514326 GAGGCCCTAAGTCGGCTCACAGG + Intergenic
1114492577 14:23112715-23112737 CAGACCCTGAGTGGGCTCCCAGG + Intergenic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1121495619 14:94389832-94389854 CAGCCAGTAAGTGGGTTCCCTGG - Intronic
1124440417 15:29681767-29681789 TTGCAACTAAGTGGGCTGCCAGG - Intergenic
1127797126 15:62448135-62448157 GAGGCACTATGCAGGCTCCCTGG - Intronic
1128002046 15:64202342-64202364 GAGACCCAAAGTGGGCTACCTGG + Intronic
1133780538 16:8935753-8935775 GAAACACCAAGTAGGCTCCCTGG + Intronic
1134102213 16:11460464-11460486 CAGCCACAAGGTGGGTTCCCAGG - Exonic
1135246256 16:20859880-20859902 GAGCCACTAAGTCTGCTCCTCGG + Exonic
1136728253 16:32380371-32380393 GAGCCACTCAGTGCCCACCCTGG - Intergenic
1137247788 16:46719629-46719651 GAGCCACTGAGTGGGGTGCTGGG + Intronic
1137608132 16:49800683-49800705 GAGCCAGTATGTGGGATACCCGG - Intronic
1141168568 16:81676873-81676895 GTGCCTCTAAAGGGGCTCCCAGG - Intronic
1202998185 16_KI270728v1_random:137383-137405 GAGCCACTCAGTGCCCACCCTGG + Intergenic
1144514809 17:15909955-15909977 GAGCCACCAGATGGGCACCCGGG - Intergenic
1147835161 17:43324808-43324830 GGGCCACTAGGAGGGCTCCTTGG - Intergenic
1148384664 17:47225502-47225524 GAGCCTCTAACTAGGCTCCTTGG + Intergenic
1148777806 17:50105437-50105459 GAGCCAGTGAGTGGGGGCCCTGG + Exonic
1152348442 17:79769264-79769286 GAGCCCCTAGAAGGGCTCCCAGG + Intergenic
1152865601 17:82720971-82720993 GATCCACTGAGAGGCCTCCCAGG + Intronic
1159452816 18:68624083-68624105 CACCCACTGACTGGGCTCCCGGG + Intergenic
1160985166 19:1835219-1835241 GACCCCCTGGGTGGGCTCCCAGG - Intronic
1166141353 19:40807052-40807074 GCGCCTCCTAGTGGGCTCCCGGG + Intronic
1167048556 19:47065747-47065769 GCGGCACTATGGGGGCTCCCTGG - Exonic
925157380 2:1658273-1658295 GAGCCACGAAGTGAGCTGCAGGG - Intronic
925920173 2:8632798-8632820 GAGCCCCTCACTGGGGTCCCTGG - Intergenic
927710560 2:25323125-25323147 GAGCCAATCAGAGGCCTCCCTGG + Intronic
933971987 2:87477269-87477291 TAGCTTCTAAATGGGCTCCCAGG - Intergenic
934665104 2:96164265-96164287 CAGCTACTAAGTGGGAACCCTGG + Intergenic
936321738 2:111472928-111472950 TAGCTTCTAAATGGGCTCCCAGG + Intergenic
938316445 2:130332492-130332514 GAGCCACTCAGCCGGCTCCATGG + Intergenic
948851399 2:240708884-240708906 GAGCCTCTAAGTTGGATCCTGGG + Intergenic
1175126049 20:56752235-56752257 TAGCCACTGAGTGGGCCCCCAGG - Intergenic
1175158536 20:56990871-56990893 GAGACTCAAAGAGGGCTCCCTGG + Intergenic
1179838335 21:44052710-44052732 GACCCACCAAGAGGCCTCCCAGG - Intronic
1182299235 22:29328696-29328718 AGGCCACTCAGTGGGCTCCCTGG - Exonic
1182338795 22:29603227-29603249 CAGCCTCTAAGTGGTTTCCCGGG + Intergenic
1182774349 22:32819859-32819881 CAGGCAGTGAGTGGGCTCCCAGG - Intronic
1184238302 22:43198265-43198287 GAGCCCCTGAGTGAGCCCCCTGG - Exonic
1184768644 22:46585763-46585785 GAGCGACAAGGAGGGCTCCCTGG + Intronic
1185020385 22:48371166-48371188 AAGCCTCTACCTGGGCTCCCAGG + Intergenic
950150736 3:10685272-10685294 AAGCCAATAAGTGTGCTCGCTGG + Intronic
952967089 3:38628139-38628161 GCGCCACTTAGTGGGCTCAGTGG - Intronic
960257221 3:115523600-115523622 GAGCCACTGAGAGGTCACCCAGG - Intergenic
960387274 3:117035519-117035541 GAGCTGCTCAGTGGGCTCCCAGG - Intronic
961005306 3:123401486-123401508 CAGCCACTATGTGGGCTCCAAGG - Intronic
961515158 3:127427714-127427736 GAGCCCTTCAGTGGCCTCCCGGG + Intergenic
961533002 3:127551311-127551333 GAGCAATTAGATGGGCTCCCAGG - Intergenic
961654723 3:128435034-128435056 GAGCCACGCAGTGAGCTCCCAGG - Intergenic
961666609 3:128496852-128496874 GGGCCACTGAGTGTGCGCCCCGG + Intergenic
966415576 3:179686295-179686317 GAGCCACTGAGTGAGCTTCCAGG - Intronic
966656788 3:182367627-182367649 GAGCCACAAAGTGGTCACACTGG - Intergenic
968610306 4:1554046-1554068 GGGCAACTGAGTGGGCTCCCTGG - Intergenic
969870462 4:10101343-10101365 GGCCCACTAAGTGGGTTGCCTGG - Intronic
971690569 4:29829098-29829120 GTGGCACAATGTGGGCTCCCAGG - Intergenic
973327496 4:48878238-48878260 GAGCCACTAGCTGTGCTGCCTGG + Intergenic
974445918 4:61980994-61981016 GATCCACAAATTGTGCTCCCTGG - Intronic
976953057 4:90857584-90857606 TAGCTACTAAAAGGGCTCCCTGG - Intronic
984341075 4:178456872-178456894 CAGCAAATAAGTGGGCTCACTGG - Intergenic
987366934 5:17157308-17157330 GAGCTTCTGAGTGGTCTCCCAGG + Intronic
989108003 5:37881243-37881265 GAGGCACTAGGGGAGCTCCCTGG - Intergenic
992614717 5:78536979-78537001 GCTCCTCTAAGTGTGCTCCCTGG + Intronic
993437601 5:87916536-87916558 GAGCTACTGATTGGGCTCACTGG - Intergenic
994038041 5:95225222-95225244 TAGCCAGTAAGTGGGCTGTCAGG - Intronic
995701437 5:114939571-114939593 GATCCAAAGAGTGGGCTCCCAGG - Intergenic
999244625 5:150147333-150147355 GAGCCCCTGAGAGGGGTCCCAGG + Intronic
1001049249 5:168401270-168401292 GAGCTTCTAAGAGGGCTACCAGG - Intronic
1002193447 5:177490419-177490441 GAGGCACTAAGGGGGTGCCCTGG + Intronic
1003484097 6:6560534-6560556 GATTCACTAGGAGGGCTCCCAGG - Intergenic
1004429930 6:15534142-15534164 GAGACACGAAGTGTGCTCTCAGG + Intronic
1005427338 6:25716616-25716638 GAGCCAGTAAGTGATCTCCCAGG + Intergenic
1005869745 6:29966029-29966051 AAGCCACTAAGTCCCCTCCCAGG + Intergenic
1006187931 6:32191106-32191128 GAGGCAGTAAGGGGGATCCCAGG - Exonic
1008043773 6:46830759-46830781 AAGCCACTCTGTGGGCTGCCTGG + Intronic
1008889141 6:56465250-56465272 CAGCTACCAAGTGGGATCCCAGG - Intronic
1016892867 6:149023783-149023805 GAGCCACTAAGTGGGTCCTCTGG - Intronic
1018952962 6:168391089-168391111 GGGCCCCTGAGGGGGCTCCCGGG - Intergenic
1024263068 7:47586332-47586354 CATCCACAAAGTGGGCTCCCAGG - Intergenic
1025014709 7:55429968-55429990 GAGCCACTGGGAGGGCTCACTGG + Intronic
1032005890 7:128301701-128301723 GGCCCGCCAAGTGGGCTCCCAGG - Exonic
1032895862 7:136250141-136250163 CAGCCACTCACTGTGCTCCCAGG + Intergenic
1033303689 7:140208964-140208986 GGCCCTCTGAGTGGGCTCCCTGG + Intergenic
1033653136 7:143356763-143356785 GAGACACTGACTGGGCTCCGGGG - Exonic
1039447379 8:37643560-37643582 GAGCCAGAAAGTGGACTCACAGG + Intergenic
1043453846 8:80394469-80394491 GAGCCACTTAGTAGCCCCCCAGG - Intergenic
1043490205 8:80741106-80741128 AAGCAACTAAGAGGGCTCCTTGG + Intronic
1053397243 9:37786107-37786129 GCGCAACTAAGTGTGCTCCAGGG - Intronic
1054986889 9:71271917-71271939 GAGCCACTAGTTTGGCTCCCTGG - Intronic
1056860754 9:90178989-90179011 GAACCATTCAGTGAGCTCCCTGG + Intergenic
1057394674 9:94669272-94669294 AAGCAACTTAGTGAGCTCCCAGG + Intergenic
1058525888 9:105857357-105857379 GAGCCAATAAGTGGTATACCTGG - Intergenic
1061386633 9:130294529-130294551 GAGGCACCAAGAGGGCTTCCTGG + Intronic
1188220266 X:27532789-27532811 GAGCCACCAAGTGCGGGCCCTGG - Intergenic
1188683584 X:33042187-33042209 GAGCCATGAGGTGGGCTGCCAGG + Intronic
1193242990 X:79194832-79194854 GCACCACTAAGTGGGCTCTTGGG + Intergenic
1195225025 X:102784173-102784195 GTCCCACCAAGTGGGATCCCAGG + Intergenic
1197910719 X:131480047-131480069 TAGCCACTCAGTGGGCTACCAGG - Intergenic
1201185287 Y:11395748-11395770 GAGCCACTCAGTGCCCACCCTGG + Intergenic