ID: 1088653288

View in Genome Browser
Species Human (GRCh38)
Location 11:111976980-111977002
Sequence CACCAAGGGAGGGCTCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 280}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088653281_1088653288 -10 Left 1088653281 11:111976967-111976989 CCGACCCCTCGTCCACCAAGGGA 0: 1
1: 0
2: 0
3: 16
4: 128
Right 1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 280
1088653275_1088653288 13 Left 1088653275 11:111976944-111976966 CCATGCGGGCCTGACCTGTCCGA 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 280
1088653277_1088653288 -1 Left 1088653277 11:111976958-111976980 CCTGTCCGACCGACCCCTCGTCC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 280
1088653276_1088653288 4 Left 1088653276 11:111976953-111976975 CCTGACCTGTCCGACCGACCCCT 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 280
1088653274_1088653288 14 Left 1088653274 11:111976943-111976965 CCCATGCGGGCCTGACCTGTCCG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 280
1088653278_1088653288 -6 Left 1088653278 11:111976963-111976985 CCGACCGACCCCTCGTCCACCAA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 280
1088653272_1088653288 21 Left 1088653272 11:111976936-111976958 CCAGAGCCCCATGCGGGCCTGAC 0: 1
1: 0
2: 0
3: 7
4: 151
Right 1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 280
1088653273_1088653288 15 Left 1088653273 11:111976942-111976964 CCCCATGCGGGCCTGACCTGTCC 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG 0: 1
1: 0
2: 4
3: 27
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088653288 Original CRISPR CACCAAGGGAGGGCTCAGAG TGG Intronic
900266129 1:1758083-1758105 AGCCAAGGGAGGGCGCAGCGGGG + Intronic
900288740 1:1914839-1914861 CAGACAGGGAGGGCTCAGTGCGG + Exonic
901037590 1:6345637-6345659 CATCCAGTGAGGGCCCAGAGAGG + Intronic
901436462 1:9250031-9250053 CTCCAAAGCAGGACTCAGAGAGG - Intronic
901878861 1:12182203-12182225 GACCAGGGGAGGATTCAGAGAGG + Intronic
902208655 1:14888632-14888654 TTCCAGGGTAGGGCTCAGAGGGG - Intronic
902610679 1:17595535-17595557 CCCCAGGGGAAGTCTCAGAGCGG - Intronic
902824603 1:18964458-18964480 CAGGAAGGGAGGGCTCATTGAGG + Intergenic
903450545 1:23451095-23451117 TACCACAGGAGGACTCAGAGAGG - Intronic
904081029 1:27872683-27872705 CACCAAGGGAGTGCTCGGAGGGG - Intronic
904360161 1:29965947-29965969 CTGCCAAGGAGGGCTCAGAGAGG + Intergenic
904757173 1:32774292-32774314 CACCAAGGCTGGGAACAGAGGGG + Exonic
904993483 1:34612867-34612889 CACCAAGGCAGAGACCAGAGTGG + Intergenic
906141384 1:43535733-43535755 CACCCAGGAAGGCCTCAGAAGGG - Intronic
908042352 1:60128187-60128209 CTCCAAAGGAGGGTTCAGTGTGG - Intergenic
915248144 1:154570394-154570416 GACCATTGGAGGGCTCAGGGAGG + Intronic
915290184 1:154878374-154878396 GCCCAAGGGAGGGCCCAGACCGG + Intergenic
915916247 1:159942569-159942591 GACCAAGGCAGGGCCAAGAGGGG + Intronic
916263161 1:162862418-162862440 CTCCATGGGAGGGAGCAGAGGGG + Intronic
916993974 1:170275711-170275733 AACCAAGGGACTGCTCATAGTGG - Intergenic
918102727 1:181390583-181390605 CTGGAAGCGAGGGCTCAGAGTGG + Intergenic
919982565 1:202651338-202651360 CACCAAGAGAGGACGCACAGGGG + Intronic
922211547 1:223490393-223490415 CACCATGGGAGGGCGCAGTAAGG + Intergenic
922933876 1:229409496-229409518 CACCCAGGGACGGCTCAGAGAGG - Intergenic
923098464 1:230793872-230793894 GACAAAGGGAGCACTCAGAGAGG + Intronic
1065659308 10:27989225-27989247 CAGCAAAAGAGGGCTCACAGAGG + Intronic
1065882645 10:30049729-30049751 CACCATGGGAGGGATTACAGAGG + Intronic
1066058012 10:31699454-31699476 CACCATGGGAGGGATCTGAATGG + Intergenic
1066827991 10:39631327-39631349 TTCCAATGAAGGGCTCAGAGAGG - Intergenic
1066853071 10:40154069-40154091 TTCCAAGGAAGGGCTCATAGAGG - Intergenic
1066853930 10:40171055-40171077 TTCCAATGAAGGGCTCAGAGAGG - Intergenic
1066872509 10:40539896-40539918 CTCCAACGAAGGGCTCATAGAGG - Intergenic
1066878409 10:40657349-40657371 TTCCAAGGAAGGGCTCATAGAGG - Intergenic
1066886224 10:40810848-40810870 TTCCAAGGAAGGGCTCATAGAGG - Intergenic
1066889120 10:40868549-40868571 TTCCAAGGAAGGGCTCATAGAGG - Intergenic
1066924856 10:41570042-41570064 TTCCAAAGGAGGGCTCAAAGAGG - Intergenic
1066925252 10:41577173-41577195 TTCCAAAGGAGGGCTCAAAGAGG - Intergenic
1066925639 10:41584303-41584325 TTCCAAAGGAGGGCTCAAAGAGG - Intergenic
1067084911 10:43232840-43232862 CAGCAAGGGTGGACTCTGAGAGG - Intronic
1067188765 10:44052619-44052641 CACCAAGGGAGGAAGCACAGGGG + Intergenic
1068117332 10:52749587-52749609 CATCAAGGGAAGGGTCAGAGTGG - Intergenic
1069083370 10:64112209-64112231 TACAAAGGAAGGGCTGAGAGAGG - Intergenic
1069688035 10:70331670-70331692 CACCAGGCCAGGGTTCAGAGTGG + Intronic
1069740342 10:70683213-70683235 CACGAAGGGAGTGCTGAGGGCGG - Intronic
1071562481 10:86655065-86655087 TATCAGGGGCGGGCTCAGAGAGG - Intronic
1071592336 10:86886636-86886658 CCCCTAGGGAGAGCACAGAGAGG + Intronic
1071911886 10:90245749-90245771 AACCAAGGGAGGGCTGGAAGTGG + Intergenic
1071985143 10:91042899-91042921 GAGCAAGGGAAGGTTCAGAGTGG - Intergenic
1072425521 10:95327050-95327072 TACCTGGGGAGGGCTCAGAGAGG - Intronic
1072688120 10:97550826-97550848 CCCCAAGGGAGGGCACCGAAAGG - Intronic
1074590600 10:114809383-114809405 CACCAAGGCATGGCTTGGAGTGG - Intergenic
1075207820 10:120462199-120462221 CACCAAGTGTGGCCTCAGTGTGG + Intronic
1075579224 10:123604155-123604177 AACCAATGCATGGCTCAGAGAGG + Intergenic
1075668610 10:124247953-124247975 CCCCAGGGCAGGGCCCAGAGGGG + Intergenic
1075951158 10:126478937-126478959 CAGCAGGGAAGGGCACAGAGGGG - Intronic
1076934172 10:133556396-133556418 CAGGAAGGAAGGGCTCAGTGAGG - Intronic
1077341465 11:2028207-2028229 CAGCAAGGAAGGGAGCAGAGAGG + Intergenic
1079116711 11:17644826-17644848 AAGCAAGGGAGGGGTCAGGGAGG + Intronic
1079186809 11:18245590-18245612 TTCCAAGGGAGGGCTCAGAGAGG + Intronic
1079190033 11:18269620-18269642 TTCCAAGGGAGGGCTCAGAGAGG - Intronic
1079239010 11:18709370-18709392 CACCAGGTGAGGACACAGAGAGG - Exonic
1080747255 11:35119327-35119349 CACCAAGGTAGGACTGTGAGGGG - Intergenic
1082803672 11:57432715-57432737 CAGCAAGTCAGGGCTAAGAGAGG - Intergenic
1083610449 11:64001757-64001779 CAAGAAGGCAGGGCCCAGAGCGG + Intronic
1083656744 11:64233732-64233754 TAGATAGGGAGGGCTCAGAGTGG - Intronic
1084267336 11:68011807-68011829 TACCAGAGGAGGGCTCAGGGAGG - Intronic
1087921062 11:103866959-103866981 CACCTAGGCATGGCTCAGAAGGG - Intergenic
1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG + Intronic
1089362849 11:117902468-117902490 GAACAGGGGAGGGCTCAGATAGG - Intronic
1089683122 11:120130496-120130518 GAGCAATGGTGGGCTCAGAGGGG + Intronic
1202824451 11_KI270721v1_random:83396-83418 CAGCAAGGAAGGGAGCAGAGAGG + Intergenic
1091657764 12:2358108-2358130 CAGCTATGGAGGCCTCAGAGGGG + Intronic
1091761134 12:3088046-3088068 CTCTACAGGAGGGCTCAGAGGGG + Intronic
1092131134 12:6114142-6114164 CACCAAGGAGGGGCTCACGGGGG - Intronic
1092148551 12:6231583-6231605 CACCAAAGGAATGCCCAGAGGGG - Intronic
1093997153 12:25654873-25654895 CACTGAGGGAAGGCCCAGAGAGG - Intergenic
1096651070 12:53062226-53062248 CACCAAAGTAGGGCTCACTGGGG - Exonic
1096786588 12:54020300-54020322 CCCAAAGAGTGGGCTCAGAGGGG - Intronic
1097178307 12:57156357-57156379 CCCCACAGGAGGGCCCAGAGAGG - Intronic
1097198916 12:57261591-57261613 CAGCAGGGGAGGACTCAGTGTGG - Intronic
1100663100 12:96722047-96722069 CACCAAAGGAGGGAACAGATGGG - Intronic
1101338006 12:103813918-103813940 CAGCAAAGGAGGGCTGAGGGTGG - Intronic
1101847648 12:108375328-108375350 CACCAACGGAAGGCCCAGACAGG + Intergenic
1102784793 12:115595673-115595695 GACCATGGGAGGGTTCAGGGGGG + Intergenic
1102918706 12:116775572-116775594 AAACTAGGGAAGGCTCAGAGAGG - Intronic
1103217910 12:119217474-119217496 AATCAAGGTGGGGCTCAGAGGGG + Intronic
1105214194 13:18274751-18274773 CAGAAAGGCAGGGCCCAGAGAGG + Intergenic
1105974189 13:25458850-25458872 TACCAAGCGAGGTCCCAGAGAGG - Intronic
1106400795 13:29428429-29428451 CGCCAGGGGAGGGCTGGGAGCGG + Intronic
1108718143 13:53102739-53102761 CACCAAAAGACGGCTCAGAGAGG + Intergenic
1111336409 13:86830466-86830488 CACCAAGGAAGGCCTCAGTAGGG + Intergenic
1111518240 13:89363287-89363309 CACGATGGGCGGGTTCAGAGAGG + Intergenic
1112693368 13:101919568-101919590 AACGAAGGGAGGGCTCTGAGAGG - Intronic
1113183753 13:107662173-107662195 CACCAAGGGAAGGAGAAGAGTGG - Intronic
1113893922 13:113751742-113751764 CGCCAAGGGAGAGACCAGAGAGG - Intergenic
1114375672 14:22144064-22144086 TACCCAGGGTGGACTCAGAGTGG + Intergenic
1114396199 14:22364357-22364379 GATCAAGGGAGGTATCAGAGAGG - Intergenic
1116016603 14:39415142-39415164 TAACAAGGGTGGGCTCAGTGTGG + Intronic
1118839484 14:69500233-69500255 CAGCAGGGGAGGGCCCAGTGCGG + Intronic
1119646798 14:76354184-76354206 GGCCAAGGAAGGGCTCACAGAGG - Intronic
1121066037 14:90965874-90965896 AAAGAAGGTAGGGCTCAGAGGGG + Intronic
1121652708 14:95571490-95571512 CAGAAAGGAATGGCTCAGAGGGG + Intergenic
1121776826 14:96596855-96596877 CACCATGGTGGGGCTCAGAGAGG - Intergenic
1121822954 14:96986289-96986311 CAGGAAGGGAGGGCTTGGAGAGG - Intergenic
1121834605 14:97080507-97080529 AAACCAGAGAGGGCTCAGAGAGG - Intergenic
1122371371 14:101230527-101230549 CCCCAAGGAAGGGCTCAGCGAGG + Intergenic
1122543567 14:102510447-102510469 CAGCAAATCAGGGCTCAGAGAGG + Intergenic
1122854808 14:104554946-104554968 CACCCAGGAAGCCCTCAGAGTGG + Intronic
1124063608 15:26319239-26319261 CACCTAGGGAGGGCTCACTGTGG + Intergenic
1124426643 15:29568952-29568974 CAGGAAGGGCGGGCTCAGGGAGG + Intronic
1124833437 15:33172517-33172539 CACCAAGGGATGGGACAGAAAGG + Intronic
1128980856 15:72184492-72184514 CACCAGGAAGGGGCTCAGAGGGG - Intronic
1129172652 15:73817520-73817542 CAGGAACGGAGGGCCCAGAGAGG + Intergenic
1129336900 15:74857701-74857723 GAAAAAGGGAGGGATCAGAGTGG - Intronic
1129852791 15:78804056-78804078 CAGCAAAGGGAGGCTCAGAGAGG + Intronic
1131976826 15:97955255-97955277 AACCAAGGGCGGTCTCAGTGGGG + Intergenic
1132414536 15:101610923-101610945 CTCAAAAGCAGGGCTCAGAGTGG + Intergenic
1132502653 16:291458-291480 CACCAAGGCAGGCCTAGGAGGGG - Intronic
1133043556 16:3073598-3073620 CAGGAAGGGAGGGCAGAGAGCGG + Intronic
1135922008 16:26659190-26659212 CACCAAACGAGGTTTCAGAGTGG + Intergenic
1136072969 16:27799585-27799607 GAGCAAAGAAGGGCTCAGAGAGG + Intronic
1136622460 16:31438533-31438555 GATCAAGCCAGGGCTCAGAGTGG - Intronic
1138583970 16:57958643-57958665 CACCGAGGGAGGGTGGAGAGGGG - Intronic
1140766918 16:78168466-78168488 AGCCAAGGGATGGCTCAGAAGGG + Intronic
1141222774 16:82086909-82086931 CACCAAGGAAGGGCTATGTGAGG - Intronic
1141359554 16:83382833-83382855 TACCATGGGTGGGGTCAGAGGGG - Intronic
1141862907 16:86730190-86730212 CAATGGGGGAGGGCTCAGAGGGG - Intergenic
1142156030 16:88533266-88533288 CACCAACGGAGAGGCCAGAGCGG + Exonic
1142210555 16:88806496-88806518 CACCATGGCGGGGCTCAGGGAGG - Exonic
1142424098 16:89991688-89991710 CAGCAAGACAAGGCTCAGAGTGG - Intergenic
1142581108 17:943382-943404 CACAGAGGGAAGGCCCAGAGAGG + Intronic
1143163344 17:4885451-4885473 CACAGAGGGAGGGGTCAGTGTGG - Intronic
1144441573 17:15287317-15287339 GAAAAAGGGAGGGCTCAGGGGGG - Intergenic
1144633869 17:16891362-16891384 CACCCAAGGAAGGCACAGAGGGG - Intergenic
1144640713 17:16935158-16935180 CACCTAGGGAGGGCTGAGGTTGG - Intronic
1144727582 17:17509602-17509624 CACTGAGGGAGGCCCCAGAGCGG + Intronic
1144837437 17:18164060-18164082 GACAAAGGGAGGGATGAGAGAGG - Intronic
1147574836 17:41593199-41593221 CTCCAGGGGAGGGTGCAGAGGGG - Intergenic
1147793295 17:43026089-43026111 AACCAAGGGAGGGGACAGAGTGG - Intronic
1147886710 17:43689083-43689105 CACCACGGCAGGACTCTGAGAGG - Intergenic
1148588224 17:48796203-48796225 GGCCATGGGAGGGCACAGAGAGG - Intronic
1148988815 17:51647489-51647511 CACCAAGGGAGGAGCAAGAGAGG - Intronic
1150653997 17:67027708-67027730 CAGCAAGAGAGAGATCAGAGGGG + Intronic
1151678200 17:75610617-75610639 CAGCCAGGGAGGGGCCAGAGAGG - Intergenic
1151698100 17:75728289-75728311 CACCAAGGGCTGGCTCAGAAGGG - Intronic
1152089752 17:78239989-78240011 GAACAAGGGAGGGGGCAGAGGGG - Exonic
1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG + Intronic
1152543120 17:80987028-80987050 CAGCAAGGAAGGGGTCAGACAGG - Intergenic
1153502916 18:5767299-5767321 TACCAAGGGAGAGCAGAGAGGGG - Intergenic
1156942180 18:42781494-42781516 CCCCCAGGGAGAGATCAGAGAGG - Intronic
1157310911 18:46552577-46552599 CCCCAAGGGAGAGCTCTGTGTGG - Intronic
1157887349 18:51381759-51381781 AACAAAAGGAAGGCTCAGAGAGG + Intergenic
1159905196 18:74083467-74083489 AACCAAGGGAGGCCTCTGACTGG + Intronic
1160152410 18:76405403-76405425 CACTCAGGAAGGGCTCAGTGAGG + Intronic
1160430056 18:78804776-78804798 CACCAAGGGCCGGCTCTCAGGGG - Intergenic
1160445447 18:78924144-78924166 CAGCAAGAAAGGGGTCAGAGAGG + Intergenic
1161738822 19:6007912-6007934 TCCCAAGGGAGGCCACAGAGAGG + Intronic
1161849571 19:6731521-6731543 CACTGAGGGTGGGCACAGAGAGG + Exonic
1164616508 19:29669774-29669796 CAGGAATGGAGGGCTCAGATTGG - Intronic
1164906898 19:31975137-31975159 GACCAAGGGAAGGCCCGGAGTGG - Intergenic
1165357258 19:35311873-35311895 CAGAAAGGGAGGGCAGAGAGAGG + Intronic
1166046151 19:40232279-40232301 CACCAAGGCAAAGCCCAGAGTGG + Exonic
1167591930 19:50408936-50408958 CCCCAAGGGAAGGCCCAGATGGG - Intronic
1168170685 19:54586657-54586679 CAGCCAGTTAGGGCTCAGAGAGG + Intronic
1168462467 19:56570612-56570634 CACAAGGGAAGGGCTCAGACTGG - Intronic
925342153 2:3145312-3145334 CGCTAAGTGTGGGCTCAGAGGGG - Intergenic
926736674 2:16078721-16078743 CACACAGTGAGGGCTCAGAATGG - Intergenic
930015049 2:46964396-46964418 CCCCATGAGAGGGCCCAGAGCGG + Intronic
932158088 2:69436773-69436795 CTCAAAGGTAGGGCTCAGGGAGG + Intronic
932493322 2:72134692-72134714 CACCCAGGGAAAGCTCAGAATGG + Intronic
934300125 2:91771999-91772021 CAGAAAGGCAGGGCCCAGAGAGG - Intergenic
934704503 2:96467494-96467516 GTCAAGGGGAGGGCTCAGAGAGG - Intergenic
934756019 2:96825324-96825346 CACCCATGCAGGGCTCAGAAGGG - Intronic
934910761 2:98252128-98252150 CACGAAGGGTGGGCGCTGAGAGG - Intronic
936345117 2:111669845-111669867 AACCAAGGGAGGGCTGAGTCAGG + Intergenic
938296212 2:130181335-130181357 CACAAAGGCATGGCCCAGAGGGG + Intronic
938366390 2:130737840-130737862 CCACACGGGCGGGCTCAGAGGGG - Intergenic
942449709 2:176101151-176101173 CGCCTAGTTAGGGCTCAGAGTGG + Exonic
944298343 2:198093016-198093038 CAGCAAGGGTGGTGTCAGAGAGG - Intronic
947320471 2:228911984-228912006 CACCAAGGATGTGCTCACAGAGG + Intronic
948993162 2:241564744-241564766 GGCCAAGGGAGGGCTGAGAGTGG - Intronic
1168867888 20:1104848-1104870 CACTAAGGAAGGGCTCTGGGAGG - Intergenic
1169195668 20:3680985-3681007 CCCCAGGATAGGGCTCAGAGGGG + Intronic
1173555793 20:43964702-43964724 GAGCAAGGTAAGGCTCAGAGTGG - Intronic
1174040118 20:47693750-47693772 CTCCAGGGGAGGGCTCAGGCCGG + Intronic
1174480665 20:50828980-50829002 GAGCAAAGGAGGGCTCAGAGAGG + Intronic
1174645838 20:52084799-52084821 GGGCAAGGAAGGGCTCAGAGAGG - Intronic
1175179440 20:57135043-57135065 AACCAAGGGAGGGAGGAGAGTGG + Intergenic
1175185667 20:57178376-57178398 CTGCAAGGGGGTGCTCAGAGTGG + Intronic
1176794867 21:13364049-13364071 CATCAAGTTAGGGTTCAGAGCGG - Intergenic
1177939292 21:27389334-27389356 ATGCAGGGGAGGGCTCAGAGAGG + Intergenic
1179570912 21:42278539-42278561 CACCAAGGGATGGCCCCGTGAGG + Intronic
1179788339 21:43741817-43741839 CAGCCAGGGTGGGCTCAGGGAGG + Intronic
1180303397 22:11054842-11054864 GCCCATGGGAGGACTCAGAGAGG - Intergenic
1180859501 22:19069223-19069245 CCCCAAGGGAGGTCACAGGGAGG + Intronic
1181023897 22:20116996-20117018 CACAAGGGAAGTGCTCAGAGGGG + Exonic
1181433004 22:22894325-22894347 GACCAATGGAGGGCACAGAGAGG + Intronic
1181541280 22:23574503-23574525 GACCAATGGAGGGCACAGAGAGG - Intronic
1181555898 22:23671524-23671546 CAGAAAGGCAGGGCCCAGAGAGG + Intergenic
1181618579 22:24071877-24071899 CACCCAGGGAGGGCAAGGAGTGG - Intronic
1181698479 22:24607129-24607151 CAGAAAGGCAGGGCCCAGAGAGG - Intronic
1181797101 22:25318819-25318841 GACCAATGGAGGGCACAGAGAGG + Intergenic
1182428172 22:30285804-30285826 CACCAAGGGCTGGGGCAGAGGGG - Intronic
1183292297 22:37010254-37010276 CCCCAAAGGAGGTCTAAGAGAGG + Intergenic
1184049948 22:41997069-41997091 CACCTACTGAGGGCTGAGAGGGG - Exonic
1184549939 22:45199182-45199204 CCCCCAGGGAGGCCTCTGAGGGG - Intronic
1185299150 22:50070451-50070473 CACCAAGGGAGGGCTAGGCCAGG + Intronic
950160593 3:10757883-10757905 CATTGAGGTAGGGCTCAGAGAGG + Intergenic
953033428 3:39192234-39192256 CCCCATGGGAGCTCTCAGAGTGG - Intronic
953761910 3:45695058-45695080 CAACCAGGGAGGGCTCAGTGAGG + Intronic
954365971 3:50146393-50146415 CACCAGTAGAGGGCACAGAGGGG - Intergenic
955929346 3:64040378-64040400 AATCAAGGGAAGGCTGAGAGTGG - Intergenic
957424449 3:80020148-80020170 CACCATGTGAGGGCATAGAGAGG - Intergenic
959357289 3:105348194-105348216 CACTAAAGTAGGGCTCAGAATGG + Intergenic
959439498 3:106359092-106359114 CACCTATGGAGGCCTGAGAGAGG - Intergenic
959668253 3:108945055-108945077 CTCCTAGGGAGTGCACAGAGTGG - Intronic
961355853 3:126339590-126339612 CCACAAGAGAGGGCTGAGAGTGG - Intergenic
962382082 3:134906031-134906053 CACCATGGGAGCGCTCAGAAGGG - Intronic
966182444 3:177198999-177199021 CCCCAAGCAAGGGCTCAGGGGGG - Intergenic
966887719 3:184386123-184386145 CACCAAGGGTAGCCCCAGAGGGG + Exonic
966916499 3:184587210-184587232 CTCCAAGGAAAGGCTCAGAGAGG + Intronic
967816999 3:193808127-193808149 CACCAAGTGAGAGCCCAGAGTGG + Intergenic
969849820 4:9947437-9947459 CACCTAGGTTGGGGTCAGAGTGG - Intronic
970730968 4:19103160-19103182 AAGCAAGGGAGGGCTTTGAGGGG + Intergenic
972880837 4:43419556-43419578 CATGAAGGGAGGGTCCAGAGAGG - Intergenic
973152455 4:46905719-46905741 CAGAAACTGAGGGCTCAGAGAGG - Intronic
975975164 4:80087146-80087168 CAGCAAGGGACAGCTCAGAAGGG + Intronic
979853965 4:125609305-125609327 CACCAAGGGAGTCCTCTAAGGGG - Intergenic
979859216 4:125672955-125672977 CACCAAGGAAGGACTAAGAAAGG - Intergenic
983664756 4:170168484-170168506 CACCATGAGAGGGCACAGTGGGG - Intergenic
984141258 4:176006033-176006055 GACAAAGGAAGGTCTCAGAGAGG + Intergenic
985802330 5:2012932-2012954 CACAAAGGCAGGGCTGAGAGTGG + Intergenic
985833382 5:2252159-2252181 CACTAAAGCAGGGCTCAGAGGGG - Intergenic
986037581 5:3954844-3954866 CACCACGGGAGGACACAGTGAGG + Intergenic
988443507 5:31258779-31258801 CACCAACGGAGGTCTCCAAGAGG - Intronic
988688681 5:33550099-33550121 CACAAGGGGTGGGGTCAGAGAGG - Intronic
988710751 5:33772100-33772122 CACCTTGGGAGGCCGCAGAGAGG - Intronic
989341167 5:40377423-40377445 CAGAAAAGGAGGGCTCAGATTGG - Intergenic
991614020 5:68477154-68477176 CTCTAAGGGAGGGCTGCGAGGGG + Intergenic
991936531 5:71807373-71807395 CACCACTGGCAGGCTCAGAGAGG + Intergenic
993500361 5:88660329-88660351 CCCCAGGGAAGGGCCCAGAGTGG + Intergenic
995018577 5:107341622-107341644 CATCCAGAGAGGGCTCACAGAGG - Intergenic
995623619 5:114054559-114054581 CACCAAAGGAGCACTCAGGGAGG - Intergenic
996045948 5:118873643-118873665 CACCAAGGGAGCCGTCAGTGGGG - Intronic
998104123 5:139457495-139457517 CATCCAGGGAGGGCCCAGTGAGG - Intronic
998643284 5:144036080-144036102 GAGCAAGGCAGGGCACAGAGAGG + Intergenic
1000245764 5:159447246-159447268 CACCAAGGTAGTGATGAGAGTGG + Intergenic
1001227206 5:169955191-169955213 CATCAAGTTAGGGTTCAGAGTGG + Intronic
1001495584 5:172185941-172185963 CAGGAAGTGTGGGCTCAGAGGGG + Intronic
1001557253 5:172645213-172645235 CAGCAAGTGGAGGCTCAGAGAGG + Intronic
1002272280 5:178080362-178080384 CACCAGGGAAGGCCTCAGAGAGG - Intergenic
1002327130 5:178416955-178416977 TACCTGGGGAGGGCTGAGAGAGG - Intronic
1006179615 6:32146953-32146975 AAACATGGGAGGGCTTAGAGAGG + Intergenic
1011346771 6:86378951-86378973 CACCAAGGGAGGGAGCACACTGG - Intergenic
1012053434 6:94373518-94373540 CTTCTAGGGAGGCCTCAGAGAGG + Intergenic
1016987145 6:149904178-149904200 CCCCAAGGGAAGGCACAAAGAGG + Intergenic
1017638338 6:156465563-156465585 CACCCAGTGAGGGCTGAGACTGG - Intergenic
1019913045 7:4113184-4113206 TCTCAAGGGAGGGCTCAGATAGG - Intronic
1019923835 7:4179721-4179743 CACCAAGGGTGCTGTCAGAGAGG + Intronic
1020351333 7:7222005-7222027 CACCAAGGAAGGTCCCATAGAGG - Intronic
1020766790 7:12332023-12332045 CCCCAAAGGAGGGTTCAGACTGG - Intronic
1022653432 7:32297671-32297693 CACCAAGAGGGGGACCAGAGGGG - Intronic
1023244682 7:38188531-38188553 CACCATGGGAGTGCTCAGAAGGG + Intronic
1023504746 7:40887914-40887936 AAACAAGGGAGGGCTCAGCAGGG + Intergenic
1024048393 7:45600798-45600820 CACCAAGGGTGTGCGCACAGAGG - Intronic
1024089664 7:45924745-45924767 GACGAGGGGAGGGCTCAGAGGGG + Intergenic
1024681006 7:51687765-51687787 AACTAAGGGAGGGCTGTGAGAGG - Intergenic
1026456304 7:70575421-70575443 CACCAAGGTGGGGCTGAGGGTGG - Intronic
1026829153 7:73600702-73600724 CCCTAAGGGTGGGCTCTGAGTGG + Intronic
1028417281 7:90594775-90594797 CACCAAGGGTGGCCTCATACCGG - Intronic
1029602943 7:101580393-101580415 CACCAGGGGAGGCCTCCCAGAGG - Intergenic
1030059921 7:105614080-105614102 GCGCAAGGGAGGGCACAGAGAGG + Exonic
1030347864 7:108454979-108455001 CACCGAGGGAGGGCGCCGAGCGG - Intronic
1030629915 7:111884581-111884603 CCCTGAGAGAGGGCTCAGAGTGG + Intronic
1032074954 7:128831846-128831868 CGCCAAGGGTGGGCTTGGAGTGG + Intronic
1032338530 7:131049051-131049073 CACCAAGGGAGTGAGAAGAGTGG - Intergenic
1035341329 7:158164503-158164525 CGCGTAGGGAGGGCTCAGAGCGG + Intronic
1037587087 8:20284684-20284706 CCCCAAGGTAGGGAGCAGAGAGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038524680 8:28262863-28262885 CAGCCAGGCAGGGCTCAGAGCGG + Intergenic
1038904535 8:31884399-31884421 CGCCAAAGCAGGCCTCAGAGGGG + Intronic
1039895855 8:41715921-41715943 AAGCAAGGCAGGGCCCAGAGAGG + Intronic
1043031950 8:75146281-75146303 CACCAAGAGAGGTCACGGAGTGG - Intergenic
1046513749 8:115232172-115232194 CACCAAAGGAGGGAACAGAATGG + Intergenic
1046815382 8:118577526-118577548 CAACATGGCAGGGCTCAAAGTGG + Intronic
1047126176 8:121963490-121963512 GAACAGGGGATGGCTCAGAGAGG - Intergenic
1047423614 8:124727285-124727307 CCCCGCGGGAGGGCTAAGAGAGG + Intronic
1047780830 8:128109606-128109628 CACACAGCGAGTGCTCAGAGAGG - Intergenic
1049070047 8:140349240-140349262 CACGACGGAAGGGCACAGAGGGG + Intronic
1049145690 8:141000384-141000406 AGCCAAGGGTGGGCTCCGAGCGG - Intronic
1049433904 8:142577480-142577502 GACCAGGGCTGGGCTCAGAGTGG + Intergenic
1049855227 8:144857466-144857488 CACAAAGGAGGGGCACAGAGTGG + Intergenic
1050361904 9:4838162-4838184 TCCCATGGGAGGGCTCAGACTGG + Intronic
1052932501 9:34067276-34067298 CACCAGGTAAGGCCTCAGAGAGG + Intergenic
1052958882 9:34277429-34277451 GACCTAGTGAGAGCTCAGAGAGG + Intronic
1053887359 9:42654142-42654164 CATCAAGTTAGGGTTCAGAGTGG + Intergenic
1054226381 9:62461593-62461615 CATCAAGTTAGGGTTCAGAGTGG + Intergenic
1054260476 9:62860875-62860897 CCCCAAGTGAGGCCCCAGAGTGG + Intergenic
1055630482 9:78218735-78218757 CACAAACGCAGGGCTCACAGAGG - Intergenic
1056382429 9:86067278-86067300 CTCCTAAGGAGGGCACAGAGTGG - Intronic
1057115068 9:92513202-92513224 CCACCAGGGAGGGCTCTGAGTGG - Intronic
1059853362 9:118367990-118368012 CAAGAAGAGAGGTCTCAGAGGGG - Intergenic
1060435205 9:123586868-123586890 AACCAAGTGGGGGCGCAGAGAGG + Intronic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061429282 9:130520990-130521012 CCCCATGGGAGGGCTGGGAGCGG + Intergenic
1061714454 9:132510071-132510093 CAAGCAGGGAGGGCTCAGGGAGG + Intronic
1062340553 9:136092175-136092197 GACCAAGGGCGTGCCCAGAGAGG + Intronic
1062730151 9:138104105-138104127 GACCAAGGGAGGCCTCAGGGTGG + Intronic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1189295510 X:39914910-39914932 CAAGAAGGGAGGACCCAGAGAGG - Intergenic
1198316251 X:135469522-135469544 CATCAAGGAAGGGCTCATGGAGG - Intergenic
1201349834 Y:13027618-13027640 AACCAAGGGAAGGCACAGACAGG + Intergenic