ID: 1088657500

View in Genome Browser
Species Human (GRCh38)
Location 11:112014574-112014596
Sequence CTGTATTGGAAGACTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088657500 Original CRISPR CTGTATTGGAAGACTGAAGA TGG (reversed) Intronic
900317588 1:2066807-2066829 GTGTTTTGGGAGGCTGAAGAGGG + Intronic
902540857 1:17153500-17153522 CTGTATGGGAAGAATGATGCTGG - Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
905150220 1:35921325-35921347 CTGTCTTGCAGGACTGGAGAAGG + Exonic
906414378 1:45608809-45608831 CTGAATTGGTACACTGAAGCAGG + Intronic
907007313 1:50928478-50928500 CTGTATTTAAAAACTGAGGAAGG + Intronic
907728032 1:57038606-57038628 CTGAATTGGAAGCTGGAAGAAGG - Intronic
907855437 1:58299096-58299118 CTGTATTGGACTACTGATAAAGG + Intronic
912578921 1:110703012-110703034 ATGTATTTGAATAATGAAGAGGG - Intergenic
912808678 1:112776811-112776833 CTTTAGTGAAAGACTGAAAAAGG - Intergenic
915223626 1:154394743-154394765 ATGGATTGGAAGACTTAATATGG - Intergenic
915349982 1:155218212-155218234 CTGTTTGGAGAGACTGAAGACGG + Intergenic
915743359 1:158137177-158137199 CTGGCTTTGAAGACTGATGAAGG + Intergenic
915993225 1:160538638-160538660 CTGTATTGGGAGGCTGAGGTGGG - Intergenic
916185426 1:162127570-162127592 CTGTATAGGAAGATTGATGTTGG + Intronic
918830527 1:189391373-189391395 ATGTATTGGAAGAATCAATATGG + Intergenic
919581903 1:199386974-199386996 CTATATTAGAAGCCTCAAGAAGG - Intergenic
920645303 1:207798923-207798945 CTGGCTTGGAAGACAGAGGAAGG + Intergenic
920863880 1:209735226-209735248 CTGCATTGGAAGTTTGGAGAGGG + Intergenic
922876225 1:228941841-228941863 CTCTTTTGGAAGAATGAGGATGG - Intergenic
1064107090 10:12509236-12509258 CTGTATTAGAAGCCTGGAGCAGG - Intronic
1064366088 10:14709286-14709308 CTTTATTGGCAGCCTGAAAATGG - Intronic
1064891795 10:20183558-20183580 CTGAATTGGGAGACAGAAGGAGG + Intronic
1068832545 10:61513445-61513467 ATGAATTGGAAGATTGAATACGG - Intergenic
1068956252 10:62820502-62820524 CTGGAGTGGAAGACAAAAGAAGG + Intronic
1069506555 10:69003559-69003581 CTGTTTTGGAAGACGTAAGAGGG + Intronic
1070276435 10:75012136-75012158 CTATACTTGAAGACAGAAGAAGG + Intronic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1072335127 10:94391118-94391140 CTGTATAGCAAGAGTGAGGAAGG + Intergenic
1072419659 10:95279426-95279448 CTGTATTAGAAGAGTCAAGAAGG - Intronic
1073332190 10:102677586-102677608 CTCTCTTAGAAGGCTGAAGAGGG + Intronic
1073715506 10:106102097-106102119 CTGTATCTGAAAACTGGAGATGG - Intergenic
1073881250 10:107982877-107982899 GTTTATTGGAAGAATGAAGGAGG - Intergenic
1074567684 10:114596082-114596104 CTGAATGGGAGGAGTGAAGAGGG - Intronic
1077561005 11:3261012-3261034 CTGTTTAGGAACACTGAAGAAGG - Intergenic
1077566902 11:3306842-3306864 CTGTTTAGGAACACTGAAGAAGG - Intergenic
1078273314 11:9817782-9817804 CTGTATTGGGAGGCTGAAATGGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078648670 11:13166821-13166843 CTGTATTGAAAGGATTAAGAGGG - Intergenic
1079543166 11:21600128-21600150 GTGCTTTGGAAGACTGAAGTGGG - Intergenic
1081118117 11:39230969-39230991 ATGTATTGGAAGGCTGAGGCGGG + Intergenic
1081226615 11:40531582-40531604 CTGAATTGAAAGAGTGAAGCTGG - Intronic
1081458195 11:43246254-43246276 CTGTATTGGAGGACAGAAGCAGG - Intergenic
1083656167 11:64230724-64230746 CTGCAAAGGAAGACTGAAGCAGG - Exonic
1085089419 11:73697591-73697613 GTGTTTTGGGAGACTGAAGCAGG - Intronic
1086205436 11:84252392-84252414 CTGTATTGGGAGGCTGAGGCGGG - Intronic
1086983088 11:93219745-93219767 CTATATTTGTAGACTGAAGCTGG + Intergenic
1087226466 11:95606385-95606407 CTTTATTGGCAGTGTGAAGACGG - Intergenic
1087662847 11:101008040-101008062 CTGGATTGGAAGATTCAAGATGG - Intergenic
1088572520 11:111236818-111236840 CTGCCTTTGAAGATTGAAGAAGG - Intergenic
1088657500 11:112014574-112014596 CTGTATTGGAAGACTGAAGATGG - Intronic
1088715502 11:112545643-112545665 CTGTACTGGAATACTGGAAAGGG + Intergenic
1089111959 11:116064284-116064306 CTGTTTTGGGAGAGTAAAGAGGG - Intergenic
1089168561 11:116496931-116496953 CTGAATTTGAAGACAGAAAAAGG + Intergenic
1090058172 11:123441110-123441132 CTTTATTGGCAGCCTGAAAATGG + Intergenic
1091189088 11:133674942-133674964 GTGTAATGGAAGCCTCAAGAAGG - Intergenic
1093595240 12:20951262-20951284 CTTTATTGGAAGACTGAGAGAGG - Intergenic
1093679665 12:21987550-21987572 CTTTATTGGAACACTGAAATAGG + Intergenic
1094144598 12:27215167-27215189 CTGTTTTGGAAGGCTGAGGCAGG + Intergenic
1094406521 12:30121852-30121874 CTGTAGGGGAAGCCTGCAGACGG - Intergenic
1097734335 12:63165461-63165483 CTGTACTATAAGACTGAAGAAGG - Intergenic
1097920621 12:65068474-65068496 CTGTGTTGGAGGAGTGGAGAGGG + Intronic
1099833251 12:87873112-87873134 CTGGGTTGGAAGACGGAGGAAGG - Intergenic
1100091222 12:90973878-90973900 ATGTAATGGAAGACTGAAGCAGG + Intronic
1100422554 12:94450744-94450766 ATGGATTGGAAGACTCAAGATGG + Intronic
1101114310 12:101517345-101517367 TTGAATTGGCAGACTGAATAAGG + Intergenic
1101248442 12:102908052-102908074 CTGTATTGGGTGATTGAAGAAGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106976907 13:35229276-35229298 GCGCTTTGGAAGACTGAAGAAGG - Intronic
1107867595 13:44717909-44717931 CTATATTGGAAGAATGGGGAAGG - Intergenic
1109401218 13:61831195-61831217 CTGAATTAGAGGACAGAAGAAGG - Intergenic
1109756946 13:66773721-66773743 CTGTATTAGAAAGCAGAAGATGG + Intronic
1110394502 13:75013847-75013869 CTGTATGGGAACACTGACCAAGG - Intergenic
1111654986 13:91140927-91140949 CTGCTTTGGAACACTGGAGATGG + Intergenic
1112182442 13:97097331-97097353 CTGGATAGGAAGACTTAATAAGG - Intergenic
1113203696 13:107893376-107893398 GTGTATGGGAATACAGAAGAAGG + Intergenic
1115772538 14:36680905-36680927 ATGTATTTGGAGACTCAAGATGG - Intronic
1117010517 14:51466843-51466865 ATGAATTGGAAGACTCAACATGG - Intergenic
1118397962 14:65353748-65353770 CTATTTTGGAAGGCTGAAGCAGG + Intergenic
1119270634 14:73301326-73301348 CAAGGTTGGAAGACTGAAGAAGG + Intronic
1120672687 14:87382295-87382317 ATGAATTGGAAGACTAAATATGG - Intergenic
1121098182 14:91232545-91232567 CTTTATTTGCAGACTGAAGTGGG + Exonic
1123413284 15:20076798-20076820 ATGGATTGGAAGACTAAACATGG - Intergenic
1123522626 15:21083909-21083931 ATGGATTGGAAGACTAAACATGG - Intergenic
1124586010 15:31007787-31007809 ATGTATTGGAAGACTCAACGTGG - Intronic
1126277525 15:46901632-46901654 GTGTATTGAAAGATTGGAGAAGG + Intergenic
1127296917 15:57616696-57616718 CTGACTTGGAAGACTGAGGCAGG + Intronic
1127903065 15:63355279-63355301 CTGTATAGGAGCACAGAAGAGGG - Intronic
1128376600 15:67080913-67080935 ATTTATTGGAAGTCTGGAGAGGG + Intronic
1130426914 15:83810685-83810707 CTGGCTTTGAAGACTGAAGAAGG - Intronic
1131340348 15:91593956-91593978 ATGGATTGCAAGACTGAATATGG - Intergenic
1132351929 15:101145141-101145163 CTGTATTGGGAGGCTGAGGTGGG - Intergenic
1133668851 16:7997981-7998003 CTGTAGTGGAAAATGGAAGAGGG - Intergenic
1137944493 16:52720643-52720665 CTTTATTGGAAGGCTGTAGTGGG - Intergenic
1140293414 16:73685400-73685422 CTGGCTTTGAAGACTGAAGCAGG + Intergenic
1141978651 16:87535492-87535514 CTGGCTTGGAAGACAGAGGAGGG - Intergenic
1142932266 17:3296902-3296924 CTGTACTGGGATATTGAAGAAGG + Intergenic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1143960348 17:10712207-10712229 CTGGCTTTGAAGACAGAAGAAGG - Intronic
1144328358 17:14203346-14203368 CCATACTGGAAGACTGAAAAGGG + Intronic
1149223741 17:54444392-54444414 CTGTATTCTAAGAGTGAGGATGG - Intergenic
1154052711 18:10976683-10976705 CAGTATAGGATGACTGCAGAGGG + Intronic
1155176390 18:23304913-23304935 GTGAATAAGAAGACTGAAGAAGG - Intronic
1155183458 18:23367866-23367888 CTGTATTGGGAGGCTGAGGCAGG - Intronic
1156540122 18:37901423-37901445 CTGCATTGGAAGAAGGAAGGTGG - Intergenic
1158574310 18:58623320-58623342 CTGTATTGGGAGTCTGAGGTGGG - Intronic
1160265293 18:77336543-77336565 CTGGCTTTGAAGACAGAAGAAGG + Intergenic
1161399966 19:4062916-4062938 CTGGATGGGAAGACTGAGGCTGG + Intronic
1162333475 19:10045331-10045353 ATGGATTGCAAGACTGAAGTGGG - Intergenic
1162484414 19:10950242-10950264 CTGTAGTGGGAGGCTGAAGTAGG + Intergenic
1163851772 19:19668522-19668544 CTGTATTGTAAGACTGATGGGGG + Intergenic
1165974131 19:39659325-39659347 CTATATTGGAAGGCTGAATTGGG - Intronic
926164309 2:10509435-10509457 ATGGATTGGAAGACTCAATATGG + Intergenic
927910550 2:26895328-26895350 ATGGATTGGAAGACTCAACATGG - Intronic
929854027 2:45620584-45620606 CTGTTTTTTAAGACTGAAGTGGG + Intergenic
930483634 2:51983723-51983745 CTGTAGTTGAATACTGGAGAAGG + Intergenic
930926664 2:56826563-56826585 CTGAATTAGAAGAATAAAGATGG + Intergenic
932746229 2:74335842-74335864 CTGGATGGGAAAACTGAATAGGG + Intronic
934719400 2:96562829-96562851 CTGGCTTTGAAGACAGAAGAAGG + Intergenic
936125457 2:109785876-109785898 CTGAATGGGTAGACTGAGGATGG + Intergenic
936219236 2:110585592-110585614 CTGAATGGGTAGACTGAGGATGG - Intergenic
937371216 2:121298756-121298778 CTGCATTGAAAGAGTGCAGAGGG - Intergenic
937852119 2:126644950-126644972 CTGTCTTACATGACTGAAGAAGG - Intergenic
938370599 2:130766008-130766030 CTTTATTTGGAGACTGAAAATGG - Exonic
939103595 2:137924430-137924452 CTATATTGGAAGAGTCAAAAAGG - Intergenic
939505989 2:143047805-143047827 CTGTAATGGGAGGCTGAGGAGGG - Exonic
939757051 2:146127544-146127566 CTGGAATGGAAAACTGAAGATGG + Intergenic
940138458 2:150465488-150465510 CTGTCTTTGAAGACAGAAAAAGG - Intergenic
942364153 2:175205138-175205160 GTTTATTGCAAGACTTAAGATGG - Intergenic
942486758 2:176447985-176448007 CTATCTTGAGAGACTGAAGATGG + Intergenic
943333217 2:186585332-186585354 CTGTTTTGCAAGGCTGAAGTGGG - Intergenic
943543404 2:189244812-189244834 CTTTATTGGCAGAGTGAAAATGG - Intergenic
943683963 2:190796931-190796953 CTGTGTGGGAAGTCTGAGGAGGG + Intergenic
943813715 2:192223852-192223874 CTGAAGTGGAAAACCGAAGAGGG - Intergenic
944865731 2:203859639-203859661 CTGAACTGGAAGTATGAAGAGGG + Intergenic
946562750 2:220930965-220930987 CTTTCTTGGAAGACTGATTAGGG + Intergenic
947538069 2:230953421-230953443 CTGGGTTTGAAGACGGAAGAAGG + Intronic
947665441 2:231902607-231902629 CTGGTTTTGAAGACGGAAGAAGG - Intergenic
1169368915 20:5013430-5013452 AGGTATGGGAAGACAGAAGAAGG + Intergenic
1173832809 20:46102889-46102911 CTGGCTTTGAAGACAGAAGATGG + Intergenic
1174421584 20:50402484-50402506 CTGTCCTGGAAGACAGCAGAGGG - Intergenic
1176699515 21:10026917-10026939 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1184932575 22:47692105-47692127 CTGTATAGTAATACAGAAGAGGG + Intergenic
950162578 3:10771473-10771495 CTGGATAAGAAGACTGAAGCTGG - Intergenic
950771115 3:15311968-15311990 CTGGACTACAAGACTGAAGATGG - Intronic
951119861 3:18913990-18914012 CTGTTTTGGAGGACAGTAGATGG - Intergenic
951829394 3:26907602-26907624 TTGTATTGAAATACTTAAGATGG - Intergenic
952866625 3:37859864-37859886 CTGTATTGGGAGGATTAAGAAGG + Intergenic
953402005 3:42631731-42631753 CTGCTTTGGATGATTGAAGATGG - Intronic
954723730 3:52589079-52589101 CTGTATTGAAAGACTGTGGGAGG - Exonic
956232093 3:67028935-67028957 GTGTTTTGGGAGGCTGAAGAGGG + Intergenic
957023966 3:75158438-75158460 CTGTATAGAATGACTGAAAATGG + Intergenic
957583109 3:82101917-82101939 CTGGCTTTGAAGACTGAAGGAGG - Intergenic
958445650 3:94211347-94211369 CTGTATTGGAAGCATGATGTTGG - Intergenic
960253501 3:115484930-115484952 CTTTCCTGGAAGACTGAAGATGG + Intergenic
960424306 3:117487477-117487499 TTGAATTGGAAGAATGAAGCTGG + Intergenic
960535953 3:118814593-118814615 TTGTATAAGAAGACTGAATATGG + Intergenic
960556827 3:119039361-119039383 CTGGATTTGAAGATAGAAGAAGG - Intronic
961348067 3:126277739-126277761 AGGTGTTGGAAGACAGAAGAGGG + Intergenic
961860091 3:129909809-129909831 CTTGATTAGAAGACTGAAAAGGG - Intergenic
962458895 3:135590988-135591010 CTATATTGGAAGGCTGGAGGAGG - Intergenic
964397601 3:156262705-156262727 CTCTTTTGGAAAACAGAAGAAGG - Intronic
965102388 3:164316060-164316082 CGGTACAGGAAGAGTGAAGATGG + Intergenic
966585622 3:181620906-181620928 CTGAGTTGCAAGACTGGAGAAGG - Intergenic
969067824 4:4502782-4502804 CTGCATAGGAAGACAGATGAAGG - Intronic
969794609 4:9517403-9517425 GTGTCTTGGAAGACTGAGGTGGG + Intergenic
970436603 4:16041641-16041663 CTGTAGTGGGAGGCTGAAGTAGG + Intronic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
971664273 4:29461511-29461533 CAATAATGGAAGACTGAAGCTGG - Intergenic
972043237 4:34630682-34630704 CTGTATTTGAAGTTGGAAGAAGG - Intergenic
974041179 4:56859163-56859185 CTGTCTTGGGAGGCTGAAGTTGG - Intergenic
974201693 4:58650348-58650370 CTGTCTTGAAACACTAAAGAGGG + Intergenic
974206889 4:58715601-58715623 CTGTTTGGGAAGAATGAATATGG - Intergenic
974267850 4:59608527-59608549 TTATATTGGAAAAGTGAAGATGG + Intergenic
977654733 4:99507720-99507742 GTGTTTTGGAAGACTGAGGTGGG - Intergenic
978273340 4:106917967-106917989 CTGTAGTGAAAGAATGAAGGTGG - Intergenic
979094063 4:116521417-116521439 ATGCATTGGAATATTGAAGAGGG + Intergenic
979127736 4:116997827-116997849 GTGTTTTGGGAGACTGAGGAAGG + Intergenic
979353383 4:119672680-119672702 CTGGATTGAAAGACTGAATGTGG - Intergenic
980371926 4:131885551-131885573 GTGCATTAGGAGACTGAAGAAGG - Intergenic
980950516 4:139371649-139371671 ATTTATTGGAAGACTGCACAGGG + Intronic
981160223 4:141488638-141488660 ATGTATTGGATGACTGAATAGGG - Intergenic
981248368 4:142567454-142567476 CTTTATCGGAAGGCTGAAGGGGG - Intronic
981363719 4:143876745-143876767 CTGTATTCGATGACTGATAAAGG - Exonic
981861777 4:149364095-149364117 CTGAACTGGAAGACTGGAGAAGG + Intergenic
981897060 4:149814870-149814892 CTGAATTGGAAGACTGAATGTGG - Intergenic
983194235 4:164787599-164787621 CTGTCATGGAAGAGAGAAGACGG - Intergenic
983675425 4:170286878-170286900 CTGTCTTGGAAGGCTGAGGCAGG - Intergenic
984800706 4:183714058-183714080 TTTTATGGGAAGGCTGAAGAGGG + Intergenic
984879320 4:184396680-184396702 CTGCACTGGAAGGCTGAAGTGGG - Intronic
985212968 4:187614979-187615001 ATGGATTAGAAGACTCAAGATGG + Intergenic
988537790 5:32084384-32084406 CTGCATTGGAAGGATGAGGACGG - Intronic
988611495 5:32730854-32730876 ATGAATTGGAAGACTCAACATGG + Intronic
990104473 5:52240235-52240257 ATGTATTGGAAGATTTAATACGG - Intergenic
990150855 5:52815589-52815611 CTCTGTTGGAAGAATGGAGAAGG + Intronic
990414912 5:55576945-55576967 TTCCATTAGAAGACTGAAGAGGG + Intergenic
990853576 5:60236755-60236777 CTGGATTTGAAGACAGAGGAAGG + Intronic
993346562 5:86790917-86790939 CTGAAATGGATGAATGAAGAAGG - Intergenic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
998768984 5:145520466-145520488 GTGTGTTGGGAAACTGAAGAAGG - Intronic
999063143 5:148656389-148656411 CTGGCTTTGAAGACAGAAGAAGG + Intronic
999421658 5:151449726-151449748 CTGTATTAGAACACTGAGCACGG + Intronic
1001165561 5:169362450-169362472 CTGGATTGAAAGACAGAAGGTGG - Intergenic
1001230037 5:169978730-169978752 TTGTCTTGGATCACTGAAGAGGG + Intronic
1002471507 5:179438602-179438624 CTGTAGTTGAGGACTGGAGAGGG - Intergenic
1005146806 6:22700989-22701011 CTGTCTTGGAAGACAGAGGAAGG - Intergenic
1006503467 6:34473143-34473165 GTGTTCTGGAAGACTGAAGGAGG + Intronic
1007197706 6:40076976-40076998 CTGTACAGGAAAACTGAACAGGG + Intergenic
1007975375 6:46095770-46095792 CTGAGTTGGAAGAATGTAGAAGG - Intergenic
1008307834 6:49926469-49926491 TTATATAGGAAGACTGCAGAAGG + Intergenic
1008612632 6:53198066-53198088 CTGCATTGGAAGACGGGAGGAGG + Intergenic
1008627137 6:53327727-53327749 ATGAATTGGAAGGGTGAAGAGGG - Intronic
1011040754 6:83027613-83027635 CAGTAATGGAAGTCTGAAGACGG - Intronic
1015039134 6:128695446-128695468 GTGAACTGGAATACTGAAGATGG + Intergenic
1015053951 6:128876336-128876358 CTTTATTGGAAGCATGAAAACGG + Intergenic
1017689590 6:156950352-156950374 CTTTAGTGGAAGACCAAAGATGG + Intronic
1022062336 7:26810087-26810109 GTGTTTTGGAAGGCTGAAGCAGG + Intronic
1024479094 7:49845609-49845631 CTGTATTTGAAGACTGACTTTGG - Intronic
1025249234 7:57340980-57341002 CTGTCCTGGAAGACAGCAGAGGG + Intergenic
1028591103 7:92496261-92496283 CTGTATATGAATACAGAAGATGG - Intronic
1030086858 7:105823505-105823527 CTATATTGGAAGTTTTAAGAAGG + Intronic
1030183927 7:106740587-106740609 CTGCATTTGAAGAATGAAAAGGG - Intergenic
1030737941 7:113072096-113072118 GTGGTTTGGAATACTGAAGAAGG - Intergenic
1031463584 7:122081323-122081345 CTGTTGTGGAAGAATGGAGAGGG - Intronic
1031571574 7:123365866-123365888 CTGATTTGGGAGACTAAAGAAGG - Intergenic
1032228202 7:130051172-130051194 CGGCGTTGGAAGATTGAAGAAGG - Intronic
1032577814 7:133074072-133074094 CTGTATTGGAAGTTTGAGAAAGG - Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1036052986 8:5220973-5220995 CAGTATGGGAATCCTGAAGAAGG + Intergenic
1037167815 8:15852386-15852408 CTGTGTTAGAGGACTGAAAATGG - Intergenic
1037803545 8:22047864-22047886 CTATTTTGGACGACTGAGGAGGG - Intronic
1039140114 8:34377669-34377691 CTGTATTGGGAGCCTGAGGCAGG + Intergenic
1039413403 8:37374385-37374407 GTGTATTTTAATACTGAAGAGGG + Intergenic
1045009730 8:97947645-97947667 ATGGATTGGAAGACTTAATATGG + Intronic
1046030616 8:108779345-108779367 CTGGCTAGGAAGCCTGAAGATGG + Intronic
1050619501 9:7437896-7437918 CTCTCTTGGAGGAGTGAAGATGG + Intergenic
1051046764 9:12884962-12884984 CTATAATGGAAGACAGCAGAGGG - Intergenic
1052317725 9:27133471-27133493 CTATGTTGGAAGATTGTAGAGGG - Intronic
1053636630 9:40013105-40013127 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1053769362 9:41451511-41451533 GTGCATTAGGAGACTGAAGAAGG + Intergenic
1054317492 9:63610179-63610201 GTGCATTAGGAGACTGAAGAAGG - Intergenic
1054548030 9:66363014-66363036 GTGCATTAGGAGACTGAAGAAGG + Intergenic
1054730879 9:68701983-68702005 CTGAATTGGAAGGTTCAAGAAGG - Intergenic
1055517002 9:77043574-77043596 CTGTGTTGAAAAACTGAAGTAGG + Intergenic
1056397789 9:86197269-86197291 TTGAATTGGTAAACTGAAGAAGG + Intergenic
1058878346 9:109264114-109264136 CTGTATTGCACGGCTGAATAAGG + Intronic
1059069218 9:111117916-111117938 CTGTAACGGAAGACTACAGATGG + Intergenic
1059741693 9:117157237-117157259 CTGTATTTGAACACAGAGGAGGG + Intronic
1059881889 9:118700139-118700161 CTGTGTTGGAAGAGTAGAGATGG - Intergenic
1060253447 9:122004597-122004619 CTGTATTGGGAGGCTGAGGTGGG - Intronic
1060731831 9:126042824-126042846 ATGGATTGGAAGACTTAATATGG - Intergenic
1060840210 9:126786998-126787020 TTGTATTTTAAGACTGAAGTGGG - Intergenic
1185934849 X:4244788-4244810 CTGTGTTTGAAGACGGAAAAGGG + Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1188096713 X:26032523-26032545 CTGTACTGGGAAACTGAAGCAGG + Intergenic
1189174993 X:38947460-38947482 CTTTCTTGGAGGACTGTAGAAGG - Intergenic
1189217820 X:39342460-39342482 AGGTATTGGAAGTCTGAAAAAGG + Intergenic
1189739166 X:44100885-44100907 CTGAAGTGGAGGTCTGAAGAGGG + Intergenic
1189740264 X:44110678-44110700 CTGTGTTTGAAGAGTGTAGAAGG - Intergenic
1193079750 X:77394728-77394750 ATGTATAGGAAGAATGAATATGG + Intergenic
1193232880 X:79068978-79069000 CTGTTTTGGAAGACTGGCTAAGG + Intergenic
1193935831 X:87619959-87619981 GTGCATTGGTAGACTGAACAAGG + Intronic
1196067452 X:111480478-111480500 ATGTATTAGAAGACTTAATATGG - Intergenic
1196631516 X:117945484-117945506 CTGCCTTGGAAGACTGCAAATGG + Exonic
1197054718 X:122103153-122103175 CTGTATTGGACAGCAGAAGATGG - Intergenic
1197828811 X:130619668-130619690 CTGTATCAGAAGACAGTAGAAGG + Intergenic
1199318908 X:146415099-146415121 CTGTCTTTGAAGATAGAAGAAGG + Intergenic