ID: 1088658622

View in Genome Browser
Species Human (GRCh38)
Location 11:112025529-112025551
Sequence GGCTCGGTGGACGGCCTTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088658617_1088658622 -5 Left 1088658617 11:112025511-112025533 CCCATGGGCGGGACTCGAGGCTC 0: 1
1: 0
2: 1
3: 3
4: 48
Right 1088658622 11:112025529-112025551 GGCTCGGTGGACGGCCTTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1088658616_1088658622 -4 Left 1088658616 11:112025510-112025532 CCCCATGGGCGGGACTCGAGGCT 0: 1
1: 0
2: 1
3: 5
4: 70
Right 1088658622 11:112025529-112025551 GGCTCGGTGGACGGCCTTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 106
1088658618_1088658622 -6 Left 1088658618 11:112025512-112025534 CCATGGGCGGGACTCGAGGCTCG 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1088658622 11:112025529-112025551 GGCTCGGTGGACGGCCTTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088658622 Original CRISPR GGCTCGGTGGACGGCCTTGC AGG Exonic