ID: 1088665077

View in Genome Browser
Species Human (GRCh38)
Location 11:112086338-112086360
Sequence GGCTGGCATTCGAAAGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088665077_1088665079 -8 Left 1088665077 11:112086338-112086360 CCCAGATCTTTCGAATGCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1088665079 11:112086353-112086375 TGCCAGCCCAGTCATGTCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088665077 Original CRISPR GGCTGGCATTCGAAAGATCT GGG (reversed) Intronic
901083268 1:6595662-6595684 GGATGGCATCAGAAAGATCCAGG - Intronic
901477923 1:9503620-9503642 AGCTGGCATTGGAAAGGTCACGG + Intergenic
902530063 1:17085291-17085313 GGCTGGCTTTCAAAAGATATAGG + Intronic
904860113 1:33530961-33530983 GGTTGGAATTGGAAAGATGTTGG + Intronic
907666715 1:56439407-56439429 GGATGACCTTGGAAAGATCTTGG + Intergenic
907717925 1:56944949-56944971 GACTGGAATTGGAAAGAGCTGGG + Intronic
911410594 1:97501449-97501471 TGCTGGCCTTCCAAAGTTCTGGG - Intronic
916051177 1:161038222-161038244 GGCTTGCATTCAAAAGTTGTCGG - Intronic
1063444825 10:6105430-6105452 TGTTGGCATTCAAAAGATTTTGG - Intronic
1065958467 10:30713900-30713922 GGCTGGCTTTCCAAAGTGCTAGG + Intergenic
1070364328 10:75721587-75721609 TGCTTGCATTCTAAAGATCCAGG - Intronic
1071260605 10:83915853-83915875 GGCTGGCATTTGACAGGTCAAGG + Intergenic
1072477674 10:95778280-95778302 GTCTGTCATTAGAAACATCTTGG - Intronic
1076215617 10:128691289-128691311 GGCTGGCATTCTTAGGATCAAGG - Intergenic
1079994031 11:27276290-27276312 GGCTGGAAGTCCAAAGATCAAGG - Intergenic
1082139215 11:48587777-48587799 AGCTGGTATTCTAAAAATCTTGG - Intergenic
1085640384 11:78189243-78189265 GGCTGGGAGTCGGGAGATCTGGG + Intronic
1088325474 11:108596352-108596374 GGGTGGAATTCCAAAGATATTGG + Intergenic
1088665077 11:112086338-112086360 GGCTGGCATTCGAAAGATCTGGG - Intronic
1088765388 11:112970520-112970542 GGCTTAGATTCGAAAGATCTGGG + Intronic
1089212519 11:116815368-116815390 GGCTGGCAGTGGCATGATCTCGG + Intergenic
1093880545 12:24399073-24399095 GGGTGGCATTGGAAAGACCGTGG - Intergenic
1101214094 12:102563473-102563495 GCCTGGCATTAGATAGATCCGGG - Intergenic
1104075835 12:125388950-125388972 GGCTGGAATGGGAGAGATCTTGG - Intronic
1112154313 13:96800712-96800734 ATCTGGCATTCGTAGGATCTCGG - Intronic
1114538261 14:23436516-23436538 GGCTGGGATTCCAAAGATGTGGG + Intergenic
1119140509 14:72263086-72263108 GGCTGGCATTCCCAACAGCTGGG + Intronic
1120960785 14:90122875-90122897 GGCAGGCTGTGGAAAGATCTGGG + Intronic
1124645819 15:31436962-31436984 GGCTGGCATTCCACACGTCTGGG - Intergenic
1130007596 15:80115474-80115496 GTCTGGCATTCAAATGATCAGGG - Intronic
1134475193 16:14567600-14567622 GGCTGGCTTTCCCAAGAACTTGG - Intronic
1137923224 16:52512726-52512748 AGCTGGCATTACAAAGAGCTGGG + Intronic
1141134678 16:81457709-81457731 GGCTGGCATGTGACAGAGCTGGG + Intronic
1149806173 17:59619971-59619993 GGCAGGCAGACGAAAGAGCTCGG - Exonic
1150749823 17:67850417-67850439 GGCTGGCAGTAGCATGATCTCGG + Intronic
1157753364 18:50196900-50196922 GGCTGCCATTAGAACCATCTGGG - Intergenic
1158877695 18:61748948-61748970 GGCTGGCATTTGAATGAGCAGGG - Intergenic
1159462642 18:68740298-68740320 TGCTGTCATTTTAAAGATCTAGG + Intronic
1163221555 19:15925067-15925089 GGCTGGGAGTCGAGAGATCTGGG + Intronic
1164685929 19:30166717-30166739 GGCTTGCCATGGAAAGATCTGGG + Intergenic
935123550 2:100202591-100202613 GGCTGGCATTTGGAAGCCCTGGG - Intergenic
936013198 2:108938828-108938850 GGCTGGCAGTGGCATGATCTTGG + Intronic
941850902 2:170179049-170179071 GACTGGCATTTGACAGAGCTTGG - Intronic
942888299 2:180955921-180955943 GTCTGGCACTTGGAAGATCTGGG + Intergenic
947176434 2:227372163-227372185 GTCTGGCATTCGCCAGAGCTCGG - Intronic
947507442 2:230719643-230719665 GCCTGGGAATCGAAAGATCTGGG + Intronic
1169783736 20:9336130-9336152 TGCTGGCATTGAAATGATCTAGG + Intronic
1169791174 20:9412334-9412356 GGCTGGGAGTCTAAAGATCAGGG + Intronic
1181237500 22:21456536-21456558 GGCTGGGATTCAAATGCTCTGGG - Intergenic
1182337797 22:29596589-29596611 GCTTGGCATTCGAAAGTGCTGGG - Intergenic
952962513 3:38601574-38601596 GGCTGGCACTAGATAGATATTGG + Intronic
955001952 3:54935298-54935320 GGCTGACATTGGGAAGATATTGG - Intronic
967684086 3:192399395-192399417 GGCTGGCATTCCCAAGATCAAGG - Intronic
969928209 4:10605136-10605158 GGCTGGCAGGCGAGAGATCCGGG - Intronic
971807479 4:31378579-31378601 GGCTGGCAAGCTAGAGATCTGGG + Intergenic
974869379 4:67620890-67620912 GGTTGGCTTTAGAAAGACCTGGG - Intronic
978724344 4:111952749-111952771 GGCAGGCATACCAAAGAGCTTGG - Intergenic
979548877 4:121967852-121967874 GGCTGGCATTCAATAAATATTGG - Intergenic
980783503 4:137522058-137522080 GGGTGGCATTCTAAAGTTATAGG - Intronic
985859810 5:2462109-2462131 CGCTGGCATCCGAATGATCCTGG - Intergenic
990101746 5:52199006-52199028 GGCTGGCATTTGACAAATCAGGG + Intergenic
992737818 5:79741315-79741337 CTCTGGCATCAGAAAGATCTGGG - Intronic
994672699 5:102781689-102781711 GGCATGCATTCTAAAGATCAAGG - Intronic
995398865 5:111718251-111718273 GGCTGGCATTTTCAAGAACTTGG - Intronic
995592184 5:113711224-113711246 GGGTGGCATTGGAGAGATATTGG - Intergenic
997525869 5:134552928-134552950 GGCTGGCCTCCGAAAGTGCTGGG + Intronic
998368850 5:141648492-141648514 AGCTGGCCTTGCAAAGATCTAGG - Intronic
1000047456 5:157533404-157533426 GGCTGGCATTTGAAAGCAGTTGG - Intronic
1001718849 5:173840099-173840121 GGCTAGCGTTGGGAAGATCTGGG + Intergenic
1001788379 5:174433441-174433463 GGATGACATTGGAAAGTTCTAGG - Intergenic
1005648704 6:27866718-27866740 TCCTTGCATTCGAAAAATCTCGG - Intergenic
1007646373 6:43384667-43384689 TGCTGGCATTAGAAAGAAATGGG - Intergenic
1013597697 6:111674771-111674793 GGCTGGGATTGGGAAGATGTAGG + Intronic
1020528047 7:9289472-9289494 GGCTGGGATTTGAAAGTCCTTGG + Intergenic
1020932694 7:14418674-14418696 GGCTTGCAGTCAAAACATCTAGG + Intronic
1021726328 7:23551050-23551072 GGTTGGCATCCCAAAGTTCTGGG + Intergenic
1022999874 7:35797712-35797734 GGCTGGCAGTGGCACGATCTTGG + Intergenic
1035365327 7:158345594-158345616 GGACGGCATTGGAAAGCTCTGGG - Intronic
1037271376 8:17134340-17134362 GGCTGGCAGGCTTAAGATCTAGG + Intergenic
1043491368 8:80752488-80752510 GGCTAGCATTATAAAGAGCTTGG - Intronic
1044240763 8:89886104-89886126 GGCTGTCAGTCAGAAGATCTGGG - Intergenic
1048702109 8:137103280-137103302 GGCTGGAAGTCGAGAGATCAGGG + Intergenic
1051381101 9:16459446-16459468 GGGTGGGATTCGAAGGCTCTGGG + Intronic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1057734904 9:97647750-97647772 AGCTGGCATTCCAAAGAACAAGG - Intronic
1060882570 9:127128550-127128572 AGCTGGCCTTGGAAAGGTCTTGG + Intronic
1061781887 9:133000999-133001021 GGCAGGCACTCGATAGATATAGG - Intergenic
1186403084 X:9277650-9277672 GGCTGCCAGTGGAAAGATCCTGG - Intergenic
1188030178 X:25255054-25255076 AGCTGGGATTGGAAAGTTCTAGG + Intergenic
1190681329 X:52829743-52829765 GCCTGGCATTCTACAGACCTCGG + Intergenic
1192076881 X:68008015-68008037 GGCAGGCAGAAGAAAGATCTTGG - Intergenic
1192169764 X:68847003-68847025 GGCTGGAAGTCGGAAGACCTGGG - Intergenic
1192240259 X:69322865-69322887 GACTGGCCTTTGAAATATCTGGG - Intergenic
1195216740 X:102711459-102711481 GGCTGGTATTCGAACCAGCTTGG - Intergenic
1198507433 X:137314338-137314360 GGCTGGCATTTGTCAGCTCTGGG + Intergenic
1200884245 Y:8252797-8252819 GGGTGCCATGCCAAAGATCTGGG + Intergenic