ID: 1088665078

View in Genome Browser
Species Human (GRCh38)
Location 11:112086339-112086361
Sequence GGGCTGGCATTCGAAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088665078_1088665079 -9 Left 1088665078 11:112086339-112086361 CCAGATCTTTCGAATGCCAGCCC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1088665079 11:112086353-112086375 TGCCAGCCCAGTCATGTCGCCGG 0: 1
1: 0
2: 2
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088665078 Original CRISPR GGGCTGGCATTCGAAAGATC TGG (reversed) Intronic
905405393 1:37729019-37729041 GGGATGTCATTCCCAAGATCAGG + Intronic
905798998 1:40831369-40831391 GGGCTGGGAGCAGAAAGATCTGG + Intronic
910814155 1:91271831-91271853 GGGCTGGGAATCAAAAGATATGG + Intronic
911410595 1:97501450-97501472 GTGCTGGCCTTCCAAAGTTCTGG - Intronic
912841337 1:113042136-113042158 GGCCTGGAATTGGAAGGATCTGG + Intergenic
920281327 1:204845945-204845967 GGGCTGGAATTCGGAAGAAATGG + Intronic
1070150809 10:73803710-73803732 GTGCTGGCATTGGAAGGAACAGG + Exonic
1072581838 10:96746591-96746613 GGGCTGTCACTCCAAAGTTCAGG - Intergenic
1078547501 11:12256722-12256744 GGCCTGGCATTTGAAGGCTCGGG + Intronic
1085640383 11:78189242-78189264 GGGCTGGGAGTCGGGAGATCTGG + Intronic
1088665078 11:112086339-112086361 GGGCTGGCATTCGAAAGATCTGG - Intronic
1088765387 11:112970519-112970541 GGGCTTAGATTCGAAAGATCTGG + Intronic
1101214095 12:102563474-102563496 TGCCTGGCATTAGATAGATCCGG - Intergenic
1102101188 12:110280638-110280660 GGGCTGGCGTGCGAAGGAGCTGG + Intergenic
1104707614 12:130959134-130959156 AGGCTGGCGTTTGGAAGATCAGG - Intronic
1106100810 13:26694222-26694244 GGGTTGGCATTGGAAGCATCAGG - Intergenic
1112614427 13:100988626-100988648 GGGATGACATTTGAAAGATTTGG + Intergenic
1114224717 14:20726995-20727017 GGGCTGGCAACAGAAAGACCAGG + Intergenic
1114538260 14:23436515-23436537 GGGCTGGGATTCCAAAGATGTGG + Intergenic
1114675443 14:24437125-24437147 GTGGTGGCATTCGGAAGACCCGG + Exonic
1119140508 14:72263085-72263107 GGGCTGGCATTCCCAACAGCTGG + Intronic
1122566834 14:102664569-102664591 TGGGTGGCATTCCAGAGATCAGG + Intronic
1124645820 15:31436963-31436985 GGGCTGGCATTCCACACGTCTGG - Intergenic
1130007597 15:80115475-80115497 AGTCTGGCATTCAAATGATCAGG - Intronic
1136403842 16:30031979-30032001 GGGCTGGCAGTCTGAAGAACAGG - Intronic
1137923223 16:52512725-52512747 GAGCTGGCATTACAAAGAGCTGG + Intronic
1139877437 16:70157395-70157417 GGGCTGGCACTCGATACCTCTGG + Exonic
1141134677 16:81457708-81457730 GGGCTGGCATGTGACAGAGCTGG + Intronic
1151307348 17:73271755-73271777 GGGCTGGGATTACAAAGGTCTGG + Intergenic
1156025369 18:32647704-32647726 GGACTGGCATGCCAAAGACCTGG + Intergenic
1156391258 18:36652637-36652659 GAGCTGGCATTCGAGACAGCAGG - Exonic
1158877696 18:61748949-61748971 TGGCTGGCATTTGAATGAGCAGG - Intergenic
1163221554 19:15925066-15925088 TGGCTGGGAGTCGAGAGATCTGG + Intronic
1165741854 19:38209614-38209636 GGGCTGGCATCCGGAGGAGCAGG + Intergenic
1168145249 19:54416610-54416632 GGGCTGGGATTGGAGAGCTCAGG + Intronic
926690740 2:15731521-15731543 GGGCTGGCACTCCAGAGATGAGG - Intronic
927517687 2:23681732-23681754 GGGCTGGGATTCTGAAGACCTGG - Intronic
934028281 2:88018644-88018666 GGGCAAGCATCTGAAAGATCTGG - Intergenic
939720191 2:145640067-145640089 GTGCTGGCATTTGAAAGTTGTGG - Intergenic
942888298 2:180955920-180955942 GGTCTGGCACTTGGAAGATCTGG + Intergenic
946043207 2:216800259-216800281 AGGCTGGCTTTCGAAAACTCTGG - Intergenic
947507441 2:230719642-230719664 AGCCTGGGAATCGAAAGATCTGG + Intronic
949020381 2:241737882-241737904 GTGCTGTCATTGGGAAGATCTGG + Intronic
1169110152 20:3027470-3027492 GGGCAGGAATGGGAAAGATCAGG - Intronic
1169791173 20:9412333-9412355 AGGCTGGGAGTCTAAAGATCAGG + Intronic
1174722222 20:52825003-52825025 GGGCTGGCAGTCTAAGGGTCAGG - Intergenic
1175609769 20:60340801-60340823 GGGCTGGAAATCCAGAGATCAGG + Intergenic
1175692976 20:61079309-61079331 GGGGTGGTATTTGAAAGAACAGG + Intergenic
1181237501 22:21456537-21456559 GGGCTGGGATTCAAATGCTCTGG - Intergenic
1181902628 22:26169095-26169117 GGGCAGGCAATGGAAAGCTCCGG + Intergenic
1182489568 22:30662271-30662293 GGGCTGTCATTGGACAGATGAGG + Exonic
952531082 3:34262687-34262709 GGGCTTGGAATCAAAAGATCTGG - Intergenic
955670262 3:61394552-61394574 GGGCTGGGATTACAAAGGTCTGG - Intergenic
964761272 3:160136974-160136996 GGGCTGGCTTTAGGAACATCAGG + Intergenic
969691127 4:8704838-8704860 GGGCTGGCATCTGACAGACCTGG + Intergenic
969928210 4:10605137-10605159 AGGCTGGCAGGCGAGAGATCCGG - Intronic
973234016 4:47877097-47877119 GGGCTGGGAGTTAAAAGATCAGG + Intronic
975445943 4:74465667-74465689 GGGCAAACAGTCGAAAGATCAGG + Intergenic
985122710 4:186660065-186660087 GGGCTGGAAATCCAGAGATCCGG - Intronic
987230524 5:15889173-15889195 GGCCAGGCATTGGTAAGATCTGG - Intronic
990101745 5:52199005-52199027 AGGCTGGCATTTGACAAATCAGG + Intergenic
990864351 5:60364649-60364671 GGGCTGGCATTTCACAGAACTGG - Intronic
992737819 5:79741316-79741338 GCTCTGGCATCAGAAAGATCTGG - Intronic
999369976 5:151048809-151048831 GGGCTGGGATTCGGAACACCAGG + Intronic
1007250248 6:40490398-40490420 GGGCTGCCATTCTGAAGCTCAGG + Intronic
1007646374 6:43384668-43384690 GTGCTGGCATTAGAAAGAAATGG - Intergenic
1007719348 6:43876137-43876159 GGGCAGGCACTGGAAAGATGGGG - Intergenic
1012882705 6:104810231-104810253 TGGCTGGAATCAGAAAGATCTGG + Intronic
1015525672 6:134174015-134174037 GGGTTGGCATTCATAAGCTCAGG + Exonic
1019000031 6:168742334-168742356 GGGCTGGCCTCCGAGACATCTGG - Intergenic
1019490670 7:1311778-1311800 GGGCTGGCAGTCCAAATATGGGG + Intergenic
1019869819 7:3749745-3749767 GGGCTGGCATTCTAGTGTTCTGG + Intronic
1034317491 7:150146655-150146677 GGCCTGGCCTTCAAAACATCCGG + Intergenic
1034775260 7:153820570-153820592 GGCCTGGCCTTCAAAACATCCGG - Intergenic
1036400215 8:8401224-8401246 GAGCTGAGATTCCAAAGATCAGG + Intergenic
1041751229 8:61263040-61263062 CAGCTGGCATTCGAAAGAGCAGG + Intronic
1042190527 8:66181185-66181207 GGGCTTGCAATCAAAAGAGCTGG - Intergenic
1044240764 8:89886105-89886127 GGGCTGTCAGTCAGAAGATCTGG - Intergenic
1048702108 8:137103279-137103301 AGGCTGGAAGTCGAGAGATCAGG + Intergenic
1048860671 8:138722566-138722588 GTGCTGGCATTCGAAATAACAGG - Intronic
1053600226 9:39602662-39602684 GGGCAAGCATCTGAAAGATCTGG + Intergenic
1053857879 9:42356518-42356540 GGGCAAGCATCTGAAAGATCTGG + Intergenic
1054253300 9:62739722-62739744 GGGCAAGCATCTGAAAGATCTGG - Intergenic
1054567417 9:66774221-66774243 GGGCAAGCATCTGAAAGATCTGG - Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic
1061677381 9:132225885-132225907 GGGATGCCATCCGCAAGATCTGG - Intronic
1192169765 X:68847004-68847026 GGGCTGGAAGTCGGAAGACCTGG - Intergenic
1192240260 X:69322866-69322888 GGACTGGCCTTTGAAATATCTGG - Intergenic
1198507432 X:137314337-137314359 GGGCTGGCATTTGTCAGCTCTGG + Intergenic