ID: 1088667464

View in Genome Browser
Species Human (GRCh38)
Location 11:112107868-112107890
Sequence TTAAGGACTTTGGAGTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088667464_1088667473 22 Left 1088667464 11:112107868-112107890 CCTACAAACTCCAAAGTCCTTAA 0: 1
1: 0
2: 1
3: 25
4: 231
Right 1088667473 11:112107913-112107935 AGCAGACTGAATCCTGCCTTAGG 0: 1
1: 0
2: 3
3: 46
4: 258
1088667464_1088667474 23 Left 1088667464 11:112107868-112107890 CCTACAAACTCCAAAGTCCTTAA 0: 1
1: 0
2: 1
3: 25
4: 231
Right 1088667474 11:112107914-112107936 GCAGACTGAATCCTGCCTTAGGG 0: 1
1: 0
2: 0
3: 20
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088667464 Original CRISPR TTAAGGACTTTGGAGTTTGT AGG (reversed) Intronic
901357518 1:8664065-8664087 TTGTGGACTTTGCAGTTAGTGGG - Intronic
901880437 1:12190864-12190886 TTTAGAACTCTGGACTTTGTGGG + Intronic
903194038 1:21671797-21671819 TTAAGGACCTTGGAGTCTGCAGG - Intergenic
904105851 1:28082819-28082841 TTAATTACTTTGGAGTTACTTGG - Intronic
906777969 1:48547142-48547164 TTAAGGAGTCTGGACTTTCTTGG + Intronic
907039852 1:51249087-51249109 TCAAGGATTTTGGAGTCAGTCGG + Intronic
908323377 1:62999895-62999917 GGAAGGAATTGGGAGTTTGTAGG + Intergenic
909799327 1:79786128-79786150 TCAAGGACTTTAGAGTTTATTGG + Intergenic
910093581 1:83494269-83494291 TGAAGGACTGTGAAGTTTTTAGG - Intergenic
910612884 1:89164243-89164265 TTAAGGTGTGTGGGGTTTGTAGG - Intronic
910780028 1:90921401-90921423 TTAAGTTCCTTGGAGTTTTTTGG - Intronic
911324467 1:96453553-96453575 TAAAGAACTTTGGAGATTTTGGG - Intergenic
912703735 1:111896993-111897015 TTAAGGAGTTTGCAGTTTGCAGG - Intronic
913406245 1:118495106-118495128 ATAAGCACTTTTCAGTTTGTTGG - Intergenic
914742351 1:150475551-150475573 TTAAGGAGTTGGGTTTTTGTGGG + Intronic
914978664 1:152392302-152392324 CCAAGAACTTTGGAGGTTGTAGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916925631 1:169517529-169517551 TTAGGGAATTTGGATTTAGTTGG + Intronic
917082148 1:171267276-171267298 TTAAGGAATTTGGATTTTACAGG - Intronic
918348553 1:183629693-183629715 TTAAAGAATTAGGAGTTTGGAGG - Intronic
918923235 1:190743708-190743730 TTAAAGACTTCTGACTTTGTAGG + Intergenic
920380818 1:205533622-205533644 TTAAGCACTTTGCAGTTTGCCGG + Intergenic
921599501 1:217091243-217091265 TTTAGGAATTTGGAATTAGTAGG - Intronic
923443836 1:234049113-234049135 GTTAAGACTTTGGAGGTTGTTGG + Intronic
1063796500 10:9518822-9518844 TAATGGACTTTGGAGATTCTGGG - Intergenic
1064405448 10:15058601-15058623 GTAAGAACTTCTGAGTTTGTGGG + Intronic
1065793249 10:29281108-29281130 TAAAGGATTTTGGAGTGTTTGGG + Intergenic
1065877423 10:30009681-30009703 TTTTGGATTTTGGAGTTTTTTGG + Intergenic
1067235891 10:44449108-44449130 TTAAGTACTTTGTAGATTCTGGG + Intergenic
1068485008 10:57646613-57646635 TTTAGAACTTTAGAGTTTATGGG + Intergenic
1070647153 10:78209980-78210002 TTAAGGAGTTTAGAGTCTGTTGG + Intergenic
1071593319 10:86897453-86897475 TTAGGGACTTAGAAGTTTTTTGG + Intronic
1072178952 10:92960489-92960511 CTGTGGACTTTGGAATTTGTGGG + Intronic
1072506426 10:96072091-96072113 TTAAGGACTATGGCCTCTGTGGG + Intergenic
1073948520 10:108780588-108780610 TGAAAGACTTTGGAATTAGTGGG - Intergenic
1074819868 10:117169776-117169798 TTTAGGAATGTGAAGTTTGTGGG - Intergenic
1076468364 10:130701370-130701392 TCAAGGAGTTTGCAGTTTGCTGG - Intergenic
1076755079 10:132565395-132565417 GTAAGGTATTTGGAGTTTATGGG + Intronic
1076940003 10:133598312-133598334 TTAAGGAGTTTCCAGTTTCTGGG + Intergenic
1080414165 11:32054130-32054152 TTAAGCACTTTGGAGTCCCTCGG + Intronic
1085110813 11:73885973-73885995 TTAAGGACTTCACAGTCTGTTGG + Intronic
1086132088 11:83411338-83411360 TTAAGAACCTTTGAGCTTGTGGG + Intergenic
1086538279 11:87876578-87876600 TCTAGGACTTTGGAGTTGGTGGG + Intergenic
1086909771 11:92458815-92458837 GCAAGGACTCTGGTGTTTGTAGG - Intronic
1086942722 11:92815128-92815150 ATAATGAATTTGGAGTTTGGGGG + Intronic
1087461556 11:98454282-98454304 TTAGGAACTCTGGGGTTTGTGGG + Intergenic
1088428074 11:109727189-109727211 TGAAAGTCATTGGAGTTTGTAGG + Intergenic
1088667464 11:112107868-112107890 TTAAGGACTTTGGAGTTTGTAGG - Intronic
1090719732 11:129460274-129460296 TTGAGGGCATTGGAGTGTGTTGG + Intergenic
1096713736 12:53477761-53477783 CGAAGGACTTTGCAGTTTTTTGG + Intronic
1097346780 12:58502015-58502037 TCAAAGACTTTGAAGTTTGAAGG - Intergenic
1099524570 12:83704042-83704064 CTAAGAACTTTAGATTTTGTGGG + Intergenic
1099897310 12:88664908-88664930 TTAAAGAATTTGCAATTTGTGGG - Intergenic
1099991758 12:89729849-89729871 GAAAGGAGTTTGGAGTTTGGAGG - Intergenic
1100396838 12:94193163-94193185 TTAAAGAATTTGAATTTTGTTGG + Intronic
1101527669 12:105546366-105546388 TAAAGGAGTTTGGATTTTGAGGG + Intergenic
1106138358 13:26991121-26991143 ATAAGAACTTTGGAGTTGGCCGG - Intergenic
1106728252 13:32509203-32509225 TTCAGGATTTTGGAGCTTCTTGG - Intronic
1107919578 13:45190121-45190143 TTAAGTTCTTTGGAGATTCTGGG - Intronic
1108845354 13:54671911-54671933 TTACAAAATTTGGAGTTTGTGGG + Intergenic
1110671924 13:78190729-78190751 TTGAATTCTTTGGAGTTTGTAGG - Intergenic
1111345592 13:86949794-86949816 TTAAAAGCATTGGAGTTTGTTGG + Intergenic
1115722364 14:36177112-36177134 TTAAGGACTTTGGGGTTTTATGG - Intergenic
1117615413 14:57529169-57529191 CTAAGGACTATAGAGTTGGTTGG - Intergenic
1118368148 14:65113274-65113296 AAAAGGAACTTGGAGTTTGTAGG - Intergenic
1120652747 14:87154226-87154248 TTGAGGGCTTGGGAGTTTGGGGG - Intergenic
1123913995 15:25002398-25002420 TTTATGACTTTGGAGTTTTGTGG + Intergenic
1123928683 15:25145391-25145413 TGAAGGAATTTGCAGTTTCTTGG + Intergenic
1125756169 15:42066482-42066504 TGAAGGATTTGGGCGTTTGTAGG + Intergenic
1126838353 15:52691087-52691109 TTAAGTGCTTTAGAGTTTCTAGG + Intronic
1126944364 15:53802570-53802592 CTAAGGATTTTGGTGTGTGTGGG + Intergenic
1127923473 15:63514383-63514405 TTAATGGTTTTGGAGTTTGCAGG + Intronic
1128963536 15:72033958-72033980 TTTAGGATTTTGGAGTTAGAGGG - Intronic
1130028351 15:80289497-80289519 AGGAGGACTTTGGAGCTTGTGGG + Intergenic
1130378546 15:83352521-83352543 GTGAGGACTTTGCAATTTGTAGG + Intergenic
1130858278 15:87861660-87861682 TACAAGACTTTGGTGTTTGTAGG + Intronic
1132155099 15:99490354-99490376 TCAAGGACTTTAGAGTTAGTAGG - Intergenic
1134101937 16:11458719-11458741 TTAACCATTTTGGAGTTTGGTGG - Intronic
1137749827 16:50852249-50852271 TTTATGAATTTGGAGTTTTTAGG + Intergenic
1137926057 16:52543381-52543403 TTTTGGATTTTGGAGTATGTTGG + Intronic
1138278625 16:55755521-55755543 GTAAGGACTTTGGACTTTGCAGG - Intergenic
1138430985 16:56969152-56969174 TTAAGGACCTTGGGGTAGGTGGG - Intronic
1139611196 16:68060168-68060190 TTAAGGGCTTGGGAGATGGTGGG + Intronic
1141349955 16:83285703-83285725 TCCAGGATTTTGGTGTTTGTGGG + Intronic
1144390645 17:14790515-14790537 TTAAAGACTTTAGAGTTACTAGG + Intergenic
1145111875 17:20170870-20170892 TCAAGGGCTTTGGAGGTGGTTGG - Intronic
1145910911 17:28542284-28542306 TCATGGATTTTGGAATTTGTGGG - Intronic
1146694309 17:34897157-34897179 ATAAGGACTTTGATGTTTGGAGG - Intergenic
1146712644 17:35056006-35056028 TTAAGGATTTTGGAGTGGGCTGG - Intronic
1146886165 17:36472327-36472349 TTGGGGATTCTGGAGTTTGTGGG + Intergenic
1147513175 17:41090142-41090164 TTAGGAACTCTGTAGTTTGTAGG - Intronic
1147515243 17:41110151-41110173 TTAGGAACTCTGTAGTTTGTAGG - Intergenic
1148112871 17:45156540-45156562 TTAAGTACACTTGAGTTTGTGGG + Intergenic
1149019674 17:51948504-51948526 TTGAGGACTCTGGAGCTTGGAGG - Intronic
1149955807 17:61048401-61048423 TTATCGTCTTTGGAGTTTCTAGG + Intronic
1151653216 17:75482889-75482911 TTAAGGAATTTGCAGTCTGGCGG + Intronic
1155487140 18:26357501-26357523 TTAAGAACTAAAGAGTTTGTTGG + Intronic
1155605035 18:27595518-27595540 TTAAGCACTTTGGCGTTTTCTGG + Intergenic
1155890300 18:31260172-31260194 TAATGGACTTTGGGGTTTCTGGG - Intergenic
1156430966 18:37074210-37074232 TCTATGACTTTGGAGTTTCTAGG + Intronic
1157215275 18:45777539-45777561 TTAAGGATTTAGGAGTTTGGTGG + Intergenic
1158144940 18:54301683-54301705 TTAAGGACCTGGGAGTCTGGAGG - Intronic
1158357781 18:56639625-56639647 CTAAGGAATTTGGATTTTGTCGG + Intronic
1158811772 18:61046533-61046555 TAATGGACTTTGGGGATTGTGGG + Intergenic
1159263264 18:66044338-66044360 TTAAGGACTCTTTAGTTTGGAGG + Intergenic
1165924471 19:39318702-39318724 TTCAGGACTTTGGAGTTGAGGGG - Intergenic
1166575726 19:43835708-43835730 ATAAGGACTTTGGGGTTGCTTGG + Intronic
1166639545 19:44483882-44483904 TCAAGGACTTTTGAGATTGAGGG - Intronic
1166903749 19:46087915-46087937 ATTAGGACTTAGGAGTTTGTGGG + Intergenic
925561807 2:5204068-5204090 TCAAGGACTTTAGAGTCTTTGGG + Intergenic
926949196 2:18223055-18223077 TTCAGGATTTTTCAGTTTGTAGG + Intronic
928224629 2:29437714-29437736 TTATGGAATTTGGGCTTTGTTGG - Intronic
928240199 2:29579386-29579408 TTAAGGCCTCTGAAGCTTGTGGG - Intronic
928682855 2:33720554-33720576 TTGAGGAATCTGGAGTTTGTGGG + Intergenic
928760710 2:34578597-34578619 TTACAGACTTTGGAGTTAGAAGG + Intergenic
929671389 2:43878621-43878643 TTGAGGCCTTTGGAGTTAGAGGG + Intergenic
931906612 2:66849740-66849762 TTAAAGTCTTTTGAGTTTCTTGG + Intergenic
932198590 2:69805786-69805808 TTTAGGACTTTTGGTTTTGTGGG + Intronic
933581826 2:84135800-84135822 TTAAAGAATTTGGTGTTAGTTGG - Intergenic
934093187 2:88572553-88572575 TTAAGTCTTTTGGAGTTGGTGGG - Intronic
935999000 2:108806539-108806561 GTAAGTACTTTGGGCTTTGTAGG + Intronic
939124520 2:138160481-138160503 CTAAGGAATCTGGAATTTGTAGG + Intergenic
940355422 2:152736912-152736934 TCATGGATTTTGGTGTTTGTGGG + Intronic
940647012 2:156402328-156402350 TTAAGGACTTCTTAGTGTGTGGG + Intergenic
942598291 2:177613584-177613606 TTAAGATCTTGAGAGTTTGTGGG + Exonic
942657256 2:178226593-178226615 TTTAGAACTTTGGTGTATGTCGG + Intronic
946586709 2:221197007-221197029 TAAAGGACTCTGGAGTTAGTGGG - Intergenic
946801845 2:223425814-223425836 CTATGGACTTTGGGGATTGTGGG - Intergenic
948331659 2:237171842-237171864 TTAATGACTTTTGAGGTTCTAGG - Intergenic
948836802 2:240629809-240629831 TTGAGGAGTTTTGTGTTTGTGGG + Intronic
1168999397 20:2156194-2156216 GGAAGGAGTTTGGACTTTGTTGG - Intronic
1170279097 20:14625795-14625817 TTGAGGGCTTTAGAGTTTCTGGG + Intronic
1171099546 20:22370068-22370090 TTAAGGACTTTTGTGTTCTTTGG + Intergenic
1171770245 20:29317720-29317742 TTAAGGACATTTGTGGTTGTGGG - Intergenic
1173949809 20:46982034-46982056 TTAAGGACCTTGCATTTTCTTGG - Intronic
1174567549 20:51476891-51476913 TCAAGTATTTTGGAGATTGTGGG + Intronic
1177002135 21:15625997-15626019 ATAAAGCCTTTGGATTTTGTAGG - Intergenic
1178184240 21:30201287-30201309 TTAAGGTCTTTGTAGATTCTGGG + Intergenic
1183861324 22:40672409-40672431 ATAAGGACTATGGAGTTAGCTGG + Intergenic
1184961459 22:47932263-47932285 TTAAGGGCTTTTGAGCTTCTTGG - Intergenic
949096363 3:90689-90711 GTAAATACTTTGGACTTTGTAGG + Intergenic
949535378 3:4991648-4991670 TTAACTACTTTAGAGTTTATTGG + Intergenic
949803107 3:7925040-7925062 TGAAGGAAATTGGAGTTTGCTGG - Intergenic
951742364 3:25938656-25938678 ATTCGGACTTTGGAATTTGTAGG + Intergenic
955955921 3:64289981-64290003 TTAATGACCTTTGAGATTGTTGG - Intronic
956107889 3:65840675-65840697 TTAAGGATTTTGGTGTGGGTGGG + Intronic
956293525 3:67687433-67687455 GTAAGTACTTTAGACTTTGTGGG - Intergenic
957888046 3:86316367-86316389 TTAAGGCTTTTGGAGTTGTTAGG + Intergenic
958929943 3:100197996-100198018 CTTAGGACTTTGGAGTTTGTGGG - Intergenic
959113710 3:102151560-102151582 TTAAGGATTTGGGAGGCTGTTGG - Intronic
959412151 3:106037798-106037820 TCAATGACTTTAGAGTTTGTTGG + Intergenic
960227859 3:115187530-115187552 TTAAGAACTCTGTAGTTTGAAGG - Intergenic
962035538 3:131647611-131647633 GCATGGACTTTGGAGTTAGTTGG + Intronic
962339399 3:134569241-134569263 TTAAGACTTTTGGAGATTGTTGG - Intronic
962652092 3:137506527-137506549 TAAAGGACTTTGCACTTTGGAGG + Intergenic
963583670 3:147157617-147157639 TGAATGACTTTGAAGTTTGAAGG + Intergenic
965243904 3:166241289-166241311 TTAAGAACTGTGAAGTTTATGGG + Intergenic
965507391 3:169531566-169531588 TTCAGGTCTTTGTAGTTTGATGG - Intronic
966254719 3:177904808-177904830 TTAAGCAGTTTGGGTTTTGTTGG - Intergenic
966458915 3:180152654-180152676 TTTAGGATTTTATAGTTTGTAGG + Intergenic
966694667 3:182777716-182777738 CTTAGGACTTTGGGGTTTGTGGG + Intergenic
966944112 3:184765640-184765662 TTAAGCATTTTCGAGTTTATTGG + Intergenic
974293001 4:59958447-59958469 TTAAAGAGTTTGGATTTTGGAGG + Intergenic
975594057 4:76030602-76030624 TTAATGAGTATGGAGTTTCTGGG - Intronic
976316016 4:83659790-83659812 ATAAGGAATTTGGATTTTTTTGG + Intergenic
977098865 4:92782222-92782244 TTCAGGAATTTGGGGTTTATTGG + Intronic
977158176 4:93600448-93600470 TTAAGTATTTTTGAGTTTATTGG - Intronic
977914650 4:102577957-102577979 TTACAGAATTTGGATTTTGTAGG - Intronic
978460537 4:108946911-108946933 TTAAGGAAGTTGAAATTTGTAGG + Intronic
979096600 4:116558780-116558802 TTAAGTTCTTTGTAGATTGTGGG - Intergenic
979690155 4:123550934-123550956 GTAAGGACGTTGGAGTTTTAGGG + Intergenic
980154580 4:129089125-129089147 TTAAGTTCTTTGTAGATTGTGGG - Intronic
981178736 4:141714338-141714360 TTAAGGATTTTGGAGGGGGTGGG - Intronic
981518206 4:145633672-145633694 TTAAGGACTTAGGTATTTATTGG + Intronic
982228731 4:153188896-153188918 TGAAAGACTTTGGATTTTCTGGG - Intronic
982470764 4:155787217-155787239 TTTAGGACTCCGGGGTTTGTAGG + Intronic
982919915 4:161260183-161260205 GTAAGAACTTTGAAGTTTTTTGG - Intergenic
983994406 4:174163697-174163719 TTAAAGAATTTGGTGTTAGTGGG - Intergenic
987987455 5:25165788-25165810 TTAGGGAATTTGGTGCTTGTTGG + Intergenic
988310785 5:29555027-29555049 TTAAGAACTTTTGAGCTTCTGGG + Intergenic
988604286 5:32666632-32666654 TCAGGGATTCTGGAGTTTGTGGG + Intergenic
988633655 5:32958089-32958111 TTAAGTACTTTGGACTTTATTGG - Intergenic
988671823 5:33389556-33389578 TGCAGGTCTTTGGAGTTTGCTGG - Intergenic
990131256 5:52588123-52588145 TAACGGGTTTTGGAGTTTGTTGG + Intergenic
991393722 5:66180105-66180127 TTAAGGACTTAGGAGTATATGGG + Exonic
993019284 5:82571928-82571950 TTAAGGAACTTTGAGTCTGTGGG + Intergenic
993904970 5:93612479-93612501 TTAAAGAATATGCAGTTTGTGGG - Intergenic
995146208 5:108789245-108789267 TTAAGGAGTTTGGGCTTTATTGG + Intronic
995651458 5:114373723-114373745 TTCACTATTTTGGAGTTTGTTGG + Intronic
995910835 5:117184514-117184536 ATAAGGACTTTGAAATTAGTTGG - Intergenic
997741386 5:136258039-136258061 TGAATGAATTTGGAGTTTGGAGG + Intronic
999701225 5:154230366-154230388 TTACGGAGTGTGGAGATTGTGGG + Intronic
1000261110 5:159589498-159589520 TTAATGACTTTGGACTCTTTTGG + Intergenic
1000853743 5:166372998-166373020 TAAAGGTCCTTGGAGTATGTTGG + Intergenic
1000864722 5:166499648-166499670 TAAAAGAGTTTGAAGTTTGTGGG + Intergenic
1001116248 5:168942748-168942770 TCAGGGCCTCTGGAGTTTGTGGG + Intronic
1001913021 5:175536600-175536622 TTAATAACTTTGGAGGTTGATGG + Intergenic
1002365350 5:178705509-178705531 TTAAGGATTTGGGACTTTGATGG + Intergenic
1008124084 6:47649352-47649374 TTTAGGATTATGGAGTTGGTGGG + Intergenic
1009190644 6:60625377-60625399 TAAAGGTCTTTTGATTTTGTAGG + Intergenic
1010538747 6:77064117-77064139 CTTAGGACTTGGGAGTTTGTGGG + Intergenic
1011569663 6:88721524-88721546 TTAAGGACATTGTAGAGTGTGGG - Intronic
1014073070 6:117205214-117205236 TGGAGGACTTTGGAGGGTGTAGG - Intergenic
1014147077 6:118010705-118010727 TTAAAGAATTTTGAGTTTCTGGG - Intronic
1015365561 6:132393652-132393674 CTTAGGACTTGGGGGTTTGTAGG - Intronic
1015397639 6:132753008-132753030 TTACGGACTTTGGGGTTTATGGG - Intronic
1016218418 6:141632555-141632577 TAAAAGACTTTTGGGTTTGTTGG - Intergenic
1016919412 6:149276504-149276526 CTAAGAAATTTGGAGTTTATAGG - Intronic
1017131805 6:151114368-151114390 TTGAAGACTTTGGAGCTTGTTGG - Intergenic
1018467706 6:164066391-164066413 AGCAGGAATTTGGAGTTTGTAGG - Intergenic
1018654858 6:166025305-166025327 TCATGCACTTTGGAATTTGTTGG - Intergenic
1020596195 7:10211093-10211115 TTAAGCACTTTGAAGGTTGCTGG - Intergenic
1021703999 7:23348922-23348944 TTAAGGACTTTTTACTGTGTTGG - Intronic
1021829700 7:24592461-24592483 TTAAGGAATTTTGATTCTGTAGG + Intronic
1024675951 7:51638104-51638126 TTCAGGCCTTTGGATTCTGTTGG + Intergenic
1027414983 7:77964803-77964825 TTATTGCCTTTGGAGTTTCTAGG - Intergenic
1028292144 7:89078357-89078379 TTAAGAACTTTGAAAATTGTTGG + Intronic
1028626200 7:92880513-92880535 CTTAGGACTTGGGGGTTTGTGGG - Intergenic
1029883430 7:103841137-103841159 TATAGAACTTTGGAGTTTGAAGG - Intronic
1030136149 7:106251592-106251614 TTAATCACTGTTGAGTTTGTTGG - Intronic
1031103756 7:117513835-117513857 TTCAGGACATAGGAGATTGTGGG - Intronic
1032554647 7:132819219-132819241 TTATAGACTTGGGAGTTTGAAGG - Intronic
1035334880 7:158121421-158121443 TCAATGAGTTTGCAGTTTGTAGG - Intronic
1036429863 8:8680145-8680167 AAATGGACTTTGGAGATTGTGGG + Intergenic
1036606983 8:10316286-10316308 TCATGGACTTTGGAGTTAGATGG + Intronic
1037936276 8:22917096-22917118 TCCAGGGCTTTGGAGTTTGCTGG + Intronic
1039781509 8:40791324-40791346 TTAAGTACTTTGGAGCTCCTAGG - Intronic
1045410075 8:101908315-101908337 TTATGTGCTTGGGAGTTTGTGGG + Intronic
1045835847 8:106520836-106520858 TTAAGGAACATTGAGTTTGTAGG - Intronic
1046707728 8:117475050-117475072 TAAAGGACTTTTGAGTTTCTTGG - Intergenic
1047698023 8:127422570-127422592 TCATGGCCTGTGGAGTTTGTAGG + Intergenic
1048718959 8:137300274-137300296 TTTAGGGCTTTGGAGTTTGCTGG + Intergenic
1049841680 8:144777366-144777388 TTAATGAATCAGGAGTTTGTGGG - Intronic
1051139239 9:13960726-13960748 TTAAGGGCATTTGAGTATGTTGG - Intergenic
1051588286 9:18749768-18749790 TTAAGGACTTTGCTGATTCTGGG - Intronic
1052655203 9:31350100-31350122 TTAAGGACTGTGGAGTTAGCTGG - Intergenic
1053409451 9:37906127-37906149 TTAAGGAGTTTGGATTTACTGGG - Intronic
1055740426 9:79382473-79382495 TTTAGGAATTTGGTCTTTGTGGG - Intergenic
1056313453 9:85366322-85366344 TGTAGGACTTTGGAGTATGAAGG + Intergenic
1057949106 9:99355839-99355861 GCAAGGACTTTGGAGTATCTGGG + Intergenic
1058204542 9:102086821-102086843 TGAAGGATTTTGGATTATGTTGG + Intergenic
1059894114 9:118840894-118840916 TTAAGTAATTTGGAGTTGGAAGG - Intergenic
1060520012 9:124288951-124288973 TTAAGTACATTGGGGTTTTTTGG + Intronic
1185875644 X:3699714-3699736 TTTAGAACTTTGGAAGTTGTGGG - Intronic
1187168636 X:16828906-16828928 CTAGGGCCTTGGGAGTTTGTTGG - Intronic
1188115775 X:26240508-26240530 TTAAGGATGTATGAGTTTGTTGG - Intergenic
1188625667 X:32281621-32281643 TTAGGCACTTTGGAGTTTAGAGG - Intronic
1188758004 X:33987809-33987831 CTTAGGACTTGGGAGTGTGTAGG + Intergenic
1189447279 X:41092564-41092586 GTAAATACTTTGGACTTTGTGGG + Intronic
1191718721 X:64211323-64211345 TTAAAGACTTTAGATTTTGCAGG + Intergenic
1191944751 X:66520240-66520262 TGAAGCACTTTGGCATTTGTTGG - Intergenic
1192803451 X:74490175-74490197 TTAGGAACTTTAGAGTTTGCAGG + Intronic
1192925672 X:75752597-75752619 TTGAGGGCTTTGGAGTTTCCAGG + Intergenic
1193442198 X:81556498-81556520 GTAAGAACTTAGGTGTTTGTGGG - Intergenic
1193694581 X:84692530-84692552 TTAAGTACTTTGTAGATTCTGGG + Intergenic
1194958019 X:100203651-100203673 TTAATGTCCTGGGAGTTTGTGGG - Intergenic
1196191086 X:112795591-112795613 GTAAATATTTTGGAGTTTGTGGG - Intronic
1199202275 X:145106265-145106287 TTAAGTACTTTTGAGTCTTTAGG - Intergenic