ID: 1088669975

View in Genome Browser
Species Human (GRCh38)
Location 11:112131421-112131443
Sequence CTGTTCCAGGGGAAGATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088669975_1088669988 19 Left 1088669975 11:112131421-112131443 CCCCAGATCTTCCCCTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 184
Right 1088669988 11:112131463-112131485 GTGCAGTCAGAGGTTTTTCCTGG 0: 1
1: 0
2: 1
3: 19
4: 133
1088669975_1088669983 -10 Left 1088669975 11:112131421-112131443 CCCCAGATCTTCCCCTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 184
Right 1088669983 11:112131434-112131456 CCTGGAACAGACATCAGATGGGG 0: 1
1: 1
2: 0
3: 18
4: 176
1088669975_1088669985 9 Left 1088669975 11:112131421-112131443 CCCCAGATCTTCCCCTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 184
Right 1088669985 11:112131453-112131475 GGGGGACCCTGTGCAGTCAGAGG 0: 1
1: 0
2: 0
3: 25
4: 250
1088669975_1088669984 -9 Left 1088669975 11:112131421-112131443 CCCCAGATCTTCCCCTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 184
Right 1088669984 11:112131435-112131457 CTGGAACAGACATCAGATGGGGG 0: 1
1: 0
2: 1
3: 12
4: 189
1088669975_1088669989 20 Left 1088669975 11:112131421-112131443 CCCCAGATCTTCCCCTGGAACAG 0: 1
1: 0
2: 3
3: 21
4: 184
Right 1088669989 11:112131464-112131486 TGCAGTCAGAGGTTTTTCCTGGG 0: 1
1: 1
2: 1
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088669975 Original CRISPR CTGTTCCAGGGGAAGATCTG GGG (reversed) Intronic
900955333 1:5883219-5883241 CTGTGCCAGGGCCAGAGCTGCGG + Intronic
901460610 1:9389025-9389047 CTGTCCCTGGGGAAGATTTATGG + Intergenic
901690305 1:10968982-10969004 CTTTTCCAGGAGAAAAGCTGTGG - Intronic
903263817 1:22144717-22144739 CAGCTCCAGGGCAAGGTCTGAGG - Intergenic
903331973 1:22601140-22601162 CTGTCCCAGGGACAGATCTGGGG - Intronic
903448164 1:23435780-23435802 CTGGTCCTGGAGAAGAACTGGGG + Intronic
905276435 1:36821603-36821625 CTGGTCCAGGGGAAGCACTGTGG - Intronic
905441789 1:38000643-38000665 CTGTTCCAGAGGCAGCTGTGTGG - Intronic
906188510 1:43880310-43880332 CTTTTCCTTGGGAAGATTTGGGG - Intronic
906509753 1:46404305-46404327 CTGCTCCTGGGGAGTATCTGGGG - Intronic
910008217 1:82426319-82426341 TTGTTGGAGGGGAATATCTGGGG - Intergenic
910844755 1:91594345-91594367 GTCTTCCAGGGGAACATCTAAGG + Intergenic
912739228 1:112178086-112178108 CAGTTGCAGGGCAACATCTGTGG + Intergenic
913452238 1:119000243-119000265 CTGTTCCACCGGAAGGACTGGGG + Intergenic
915492572 1:156259285-156259307 GGGCTCCAGGGGAAGATTTGTGG + Intronic
917482689 1:175425696-175425718 CAGTGCCAGGGGAAAATGTGTGG - Intronic
919879772 1:201893837-201893859 CTGATCCAGGGGCAGACATGTGG - Intergenic
921456175 1:215374865-215374887 CTGTTTCAGGAGCAGAGCTGCGG - Intergenic
921817197 1:219577253-219577275 CTGCTCCAGGGGTACAGCTGGGG + Intergenic
1063261055 10:4389741-4389763 CTGTTCCAGGTGAACACCTCTGG + Intergenic
1068652587 10:59539023-59539045 CTGTACCAGCGATAGATCTGAGG - Intergenic
1068946124 10:62730638-62730660 CTGTGCCAGGGGTATATCTTGGG + Intergenic
1069062246 10:63906347-63906369 TTGTTACAGGGGAAGAATTGTGG + Intergenic
1069921943 10:71820840-71820862 CTGTTACAGAGGATGTTCTGTGG + Intronic
1070787474 10:79170356-79170378 CTCTACCAGGGGCAGATCTGTGG + Intronic
1075531260 10:123231935-123231957 CTGTCCCCGGTGAACATCTGGGG - Intergenic
1075596373 10:123732582-123732604 CAGTCCCATGGGAAGTTCTGGGG + Intronic
1076135047 10:128039955-128039977 GAGTGCCAGGTGAAGATCTGAGG + Intronic
1076478395 10:130768109-130768131 GTGATCCAGGGGTAGAGCTGGGG - Intergenic
1077353394 11:2103442-2103464 CTGTTCCAGGGACAGCTCTGTGG - Intergenic
1077949936 11:6945502-6945524 CTGTTTCAGGTGAATGTCTGGGG - Intronic
1079975188 11:27082337-27082359 CTGTTCCACGGGGAGGTGTGTGG + Intronic
1081678479 11:44985219-44985241 CCGTTCCTTGGGAAGAACTGAGG + Intergenic
1082693447 11:56332067-56332089 CTGTCCGAAGGGAAGCTCTGCGG + Intergenic
1085052782 11:73388394-73388416 GTCTGCCAGGGGAAGAGCTGTGG + Intronic
1085740335 11:79073145-79073167 CTGTGCCAGGGGAATTTTTGAGG + Intronic
1085809734 11:79668990-79669012 CAGTACCAGGAGAAGATCTTGGG - Intergenic
1088669975 11:112131421-112131443 CTGTTCCAGGGGAAGATCTGGGG - Intronic
1091004672 11:131942314-131942336 TTCTTCCAGGGGATGATTTGGGG + Intronic
1094263648 12:28529273-28529295 CTGTTCTAGGCAAAGCTCTGCGG - Intronic
1095183205 12:39170457-39170479 CTGTTAAAGGGGTAGATCTCAGG + Intergenic
1095248134 12:39946243-39946265 CTGTTCCAGTGGAGGTTGTGGGG + Intronic
1096260802 12:50089834-50089856 CTCTCCCAGAGGAAGAGCTGGGG - Intronic
1100689715 12:97026814-97026836 CTTTTCCAGGGGAAAATTTCAGG + Intergenic
1101169078 12:102069300-102069322 CTATTCCAAGGGAACGTCTGTGG - Intergenic
1101188156 12:102303724-102303746 CTGTTCCAGGACCAGAGCTGTGG - Intergenic
1103984171 12:124756014-124756036 CTGTTTACGGGGCAGATCTGAGG - Intergenic
1104921740 12:132294199-132294221 CTGCTCCAGGGACAGCTCTGGGG - Intronic
1106599732 13:31177270-31177292 GTGTTACAGGGGAATACCTGAGG - Intergenic
1110103789 13:71644564-71644586 CTTTTCTTGCGGAAGATCTGAGG - Intronic
1113005505 13:105697398-105697420 CTGTTTCAGGGAAAGTTTTGTGG - Intergenic
1113937201 13:114000739-114000761 CTTTTTCAGGGGGAGAGCTGAGG - Intronic
1115377737 14:32696488-32696510 TTTTTCCCTGGGAAGATCTGAGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1119244587 14:73093207-73093229 CTGCTTCAGGGGAACATCTTTGG + Intronic
1121027060 14:90624332-90624354 CTGCCCCTGGGGAAGCTCTGGGG + Intronic
1121145223 14:91577177-91577199 CTGGTCCAAGGGAAGCTCGGAGG + Intergenic
1121235574 14:92389422-92389444 CTGTTCATGGGGAAGAACGGTGG - Intronic
1121624531 14:95374610-95374632 CTGTTCCAGGGGGAGAGCACAGG - Intergenic
1127367477 15:58305219-58305241 CTGCTTCAGGGGAAGGTCAGAGG - Intronic
1129605390 15:77022602-77022624 CTGATCTTGGGGAGGATCTGGGG - Intronic
1129732217 15:77939029-77939051 CTGTCCCAGAGGCAGGTCTGAGG - Intergenic
1131076330 15:89497075-89497097 CTGTTCCAGGGTCAAGTCTGGGG - Intergenic
1134452331 16:14371153-14371175 CTCTTCCCAGGGAAGATATGGGG - Intergenic
1137397151 16:48124271-48124293 CTCTGGCAGGGGAAGATCTTGGG - Exonic
1137598896 16:49743074-49743096 CTGTGCCAGGGGCAGGCCTGAGG + Intronic
1140311243 16:73850598-73850620 CCATCCCAGGGGAAGCTCTGGGG + Intergenic
1141303942 16:82843452-82843474 CCGACCCAGGGGAAGATATGTGG + Intronic
1142869712 17:2812180-2812202 CTGTTCTTGGGGATGACCTGGGG - Intronic
1148558584 17:48593141-48593163 CTCATCCAGGGGAATATTTGCGG + Exonic
1149581357 17:57752499-57752521 CTGTTCCAAGGGTTGATCTGGGG + Intergenic
1151217675 17:72588923-72588945 TTCTTCCAGGAGAAGATTTGGGG - Intergenic
1154193756 18:12251533-12251555 CTGTGACAGATGAAGATCTGAGG + Intergenic
1156200203 18:34822010-34822032 TTGTTCCCGGGGATGCTCTGAGG + Intronic
1156577104 18:38329920-38329942 CTCTACAAGGTGAAGATCTGAGG - Intergenic
1157279570 18:46337039-46337061 CTGTTAAAGGGGCAGCTCTGAGG - Intronic
1157325230 18:46664276-46664298 CTCTTCCATGGGAAGGCCTGTGG + Intergenic
1157447338 18:47755281-47755303 CTGTTCTCAGGGAAGAGCTGAGG - Intergenic
1159014599 18:63090817-63090839 CTGTGCCTGGGGAGGAACTGGGG + Intergenic
1160063070 18:75549880-75549902 CGGGTGCATGGGAAGATCTGGGG + Intergenic
1160258043 18:77264280-77264302 ATGTCCCAAGGGAAAATCTGTGG + Intronic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1160723602 19:608168-608190 CAGTACCAGGAGAAGGTCTGAGG + Exonic
1160856724 19:1221130-1221152 CTGTCCCTGGGGTAGAGCTGGGG + Intronic
1161349439 19:3784010-3784032 TGGTTCCACGGGAAGATCTCGGG - Exonic
1162284402 19:9727419-9727441 CCTTTCAATGGGAAGATCTGGGG - Intergenic
1162487243 19:10968739-10968761 CTGTTCCAGTGGGAGACTTGAGG + Intronic
1164155719 19:22595954-22595976 CTGCTCCAGGGGCAGAACGGCGG - Intergenic
1166689320 19:44813244-44813266 CTGTTGCAGGTGGCGATCTGAGG - Exonic
1167019323 19:46861868-46861890 CAGTCCAAGGGGAAGACCTGGGG - Intergenic
925911569 2:8576942-8576964 CTGCTCAAGGGGAAGTCCTGTGG - Intergenic
926060707 2:9802967-9802989 CGGCTTCAGGGGAAGAGCTGAGG - Intergenic
929024328 2:37585239-37585261 CTGTTCCACCTGAAGATTTGAGG - Intergenic
929954145 2:46442816-46442838 CCATTCCAGGGGCAGAACTGGGG - Intronic
930528652 2:52563637-52563659 CTGCTCCAGGGGAAAATCAATGG + Intergenic
931100518 2:58994688-58994710 CTGCTGCAGGGGTAGATTTGGGG - Intergenic
933173865 2:79155792-79155814 CAGTTCCAGGCGAGGCTCTGTGG - Intergenic
935561002 2:104560049-104560071 AAGTTCAAGGGGAAGATCTTGGG + Intergenic
935705424 2:105852313-105852335 GTGGCCCAGGGGAAGTTCTGTGG + Intronic
942141088 2:172978203-172978225 CATTTCCAGGGGAAGCTCTGGGG - Intronic
944293919 2:198040558-198040580 CCGTTCTAGAGGAGGATCTGAGG + Intronic
945264117 2:207873510-207873532 ATGTTGCAAGGGAATATCTGCGG + Intronic
946481077 2:220057356-220057378 CTGGTCCCGGGGTAGGTCTGGGG - Intergenic
946766470 2:223045268-223045290 CCCTTCCTGGGGAAGATGTGGGG - Intergenic
947760371 2:232599688-232599710 GTGATCCAGCGGAAGATCTGAGG + Intergenic
947864720 2:233388412-233388434 CCGTCCCAGGGGAGGAACTGGGG + Intronic
947967561 2:234294258-234294280 CTGTGCCAGGGGATGAGTTGGGG + Intergenic
948091131 2:235296683-235296705 CTGTTGCATGGGAAGGCCTGGGG - Intergenic
949072811 2:242036273-242036295 GTGTTCCAGGGGAGGATGTGAGG + Intergenic
1169252586 20:4071909-4071931 CTGATCCAGGGGAAGCTCTGGGG + Intronic
1169266069 20:4168037-4168059 CTGCTCCAGGGGCACATCTTTGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175584287 20:60125739-60125761 CTGTTTCAGGATAAGATCTGCGG - Intergenic
1175600243 20:60266977-60266999 ATTTACCAGGGGAAGAGCTGGGG - Intergenic
1177142502 21:17372628-17372650 CAGTTCCAGGGGAAAAAATGAGG - Intergenic
1177173105 21:17675567-17675589 AGGTTCCAGGGGAAGGTCTCAGG + Intergenic
1184652891 22:45927182-45927204 ATGTGCCAGGGGCAGAGCTGGGG + Intronic
949118270 3:355462-355484 AGGTTCCAGTGGAAGATTTGGGG - Intronic
949542226 3:5041865-5041887 CTGTGTCAGAGGAAGATCTGGGG + Intergenic
950868044 3:16205104-16205126 CTTTTCCAGGGGCAGATACGAGG - Intronic
951680995 3:25294584-25294606 CTGTTGGAGGTTAAGATCTGGGG + Intronic
953907389 3:46875118-46875140 GTGTTCAATGGGAAGAACTGTGG - Intronic
954378365 3:50206387-50206409 CTTTTCCAGGGGCAGCTCTGTGG - Intronic
954772715 3:52987095-52987117 CTGTCCCACTGGAAGATCTTCGG + Intronic
962082494 3:132155593-132155615 CTGTTGCAGAGGGAGATGTGTGG - Intronic
963892999 3:150656833-150656855 CTGTTTCAGGGTAAGATTTTGGG + Intergenic
965658925 3:171020352-171020374 CTAATCCAGTAGAAGATCTGGGG - Intronic
966443381 3:179973311-179973333 CTGTTCCTGGGCAAGATCTGTGG - Intronic
966665249 3:182464533-182464555 CTAGTCCAGGAGAAGATCTGTGG + Intergenic
966917120 3:184591113-184591135 CTGTTCCTGGGGATGGGCTGGGG - Intronic
967117738 3:186356903-186356925 CTCTTCCAGGGGAGGAGATGGGG + Intronic
967118046 3:186359983-186360005 CTCTTCCAGGGGAGGAGATGGGG + Intronic
967872723 3:194245622-194245644 ATGTCCCATGGGAAGATTTGGGG + Intergenic
968062502 3:195736624-195736646 CTGTTACATGGGGAGATTTGAGG - Intronic
969966797 4:11004954-11004976 CTCCACCTGGGGAAGATCTGAGG - Intergenic
972568307 4:40288205-40288227 CTAATCCAGGGGAACCTCTGGGG + Intergenic
975886453 4:78971840-78971862 CTGTGCCTGGTGAAGACCTGTGG + Intergenic
978742761 4:112156262-112156284 CTCTGCCAAGGGAAGATCTGGGG - Intronic
982161497 4:152574450-152574472 CAGTTTCAGGGGAATAGCTGTGG + Intergenic
988273743 5:29053423-29053445 GTGTTACAGGGAGAGATCTGGGG - Intergenic
989463211 5:41725184-41725206 CTGTTCCAGAGGGGGAGCTGAGG + Intergenic
989782663 5:45288036-45288058 ATATTCTTGGGGAAGATCTGTGG + Intronic
993320294 5:86462065-86462087 CTTTTCAGTGGGAAGATCTGGGG + Intergenic
993482938 5:88447673-88447695 CTGGTCCAGGGTAAGGTCTGTGG - Intergenic
995652399 5:114384619-114384641 GTGCTCCAGGGAAAGATCTCTGG + Intronic
996522961 5:124447929-124447951 CTGTTCCAGGGGCAGAATTGAGG - Intergenic
998201876 5:140131232-140131254 CAGTTTCAGGGGAAAAACTGTGG - Intergenic
998379738 5:141715765-141715787 CTCTTCCAGGAGCAGATCTGGGG - Intergenic
998874092 5:146582051-146582073 ATATTGCAGGGGAAGCTCTGTGG - Intronic
999935516 5:156481749-156481771 CTGTTTCATGGAAACATCTGAGG + Intronic
1001556338 5:172640106-172640128 CTGTACCATTGGAAGATCTTGGG + Intergenic
1005465584 6:26109339-26109361 CTGTTCCAGTAGAAGCTCAGGGG - Intergenic
1005938824 6:30545908-30545930 CTGTTCCAGGCTAACAGCTGTGG - Exonic
1006579428 6:35068339-35068361 CTGTGCCTGGGGAAGCTCTGGGG + Intronic
1007365180 6:41386389-41386411 CTGGCCCAGGGGAAGGGCTGAGG + Intergenic
1010625139 6:78130147-78130169 TTGTGGAAGGGGAAGATCTGTGG - Intergenic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1010830334 6:80520041-80520063 CTGATACAGGAGAAGATCTATGG - Intergenic
1015644115 6:135367981-135368003 ATGTCAGAGGGGAAGATCTGTGG + Intronic
1016609934 6:145977242-145977264 CTGTTCCAGGTTAGGATCAGAGG + Intergenic
1016862762 6:148737291-148737313 ATCTTCCTGGGGAAGTTCTGGGG - Intergenic
1018907277 6:168082905-168082927 CAGTGCCTGGGGAAGAACTGGGG - Intergenic
1019051469 6:169186830-169186852 CAGGTCCAGGGGTAGCTCTGAGG + Intergenic
1019289134 7:241475-241497 CTGTGCCAGGGAAAGATCGATGG + Intronic
1019887632 7:3919271-3919293 CTCTGCCAAGGCAAGATCTGGGG + Intronic
1020006777 7:4787628-4787650 CTGTTCCAGGCCAGGAACTGTGG - Exonic
1022096200 7:27143066-27143088 CGCATCCAGGGGTAGATCTGGGG + Exonic
1022673842 7:32480094-32480116 CTGTTACCTGGGAAGATCAGAGG - Intergenic
1022755251 7:33280713-33280735 ATGTGTCAGGGGAAGAGCTGTGG + Intronic
1024828108 7:53416285-53416307 CTGTTCCTAAGGAAGAGCTGAGG - Intergenic
1026284863 7:68954403-68954425 CTCTTCCTGGGGAAGATTTGAGG - Intergenic
1026932232 7:74229723-74229745 CTGTCTCATGGGAAGAGCTGGGG + Exonic
1027126059 7:75557558-75557580 CTGCTCCATGGGCAGTTCTGTGG - Intronic
1027743845 7:82047936-82047958 CTGAGCTGGGGGAAGATCTGGGG + Intronic
1028284977 7:88985043-88985065 CTGTTCAAGAGGAATATCTAAGG + Intronic
1034498968 7:151438036-151438058 CTGTTCCAGCGGAAGAAGTCGGG + Exonic
1034750820 7:153567464-153567486 CTGCTACAGAGGAATATCTGAGG + Intergenic
1035243567 7:157547923-157547945 CTGCTCCAGGGGAAGCTCCCTGG + Intronic
1035346390 7:158202458-158202480 CTGGGCCTGGGGAAGAGCTGGGG + Intronic
1035553155 8:545049-545071 CTGGTCCTGGGGAAGGTTTGGGG - Intronic
1036173751 8:6515983-6516005 CTGTTCCAGGGACAGTTCTCTGG - Intronic
1036766008 8:11549685-11549707 CTGTTCCAGGGAAAGAAGCGGGG - Intronic
1037529002 8:19756587-19756609 CTGTTCGAGGGCATGATCTTGGG - Intronic
1039854090 8:41397810-41397832 CTGTTCCTGGGGAAGCACAGAGG - Intergenic
1046800989 8:118426340-118426362 CTGTTACAGGTGAAGAAGTGAGG - Intronic
1048085804 8:131178209-131178231 TTGTCCCACTGGAAGATCTGTGG + Intergenic
1049275178 8:141716779-141716801 CAGTTCCAGGGGAAGGTCTCCGG - Intergenic
1049296449 8:141842933-141842955 CTCCTCCAGGGGAAGATCTCAGG - Intergenic
1055317239 9:75046433-75046455 GTGTTCCAGGGGAACACCAGAGG - Intergenic
1055760677 9:79604198-79604220 ATGAGCCATGGGAAGATCTGGGG + Intronic
1056291585 9:85148962-85148984 CTGTTCCATAGCAAGATTTGGGG + Intergenic
1056731522 9:89170080-89170102 CTTTTCCTTGGGAAGATCCGAGG + Intronic
1057303042 9:93897341-93897363 CTGTTCCCTGGGAACATCTCTGG + Intergenic
1059548075 9:115199194-115199216 TTGTTCCAGGGCAAGCTCCGAGG + Intronic
1061290995 9:129650109-129650131 CTGTTCGAGGAGGAGAGCTGGGG + Intergenic
1062300287 9:135863285-135863307 CAGATACAGGGGCAGATCTGAGG - Intronic
1062453108 9:136623747-136623769 CTGCTTCAGGGGCAGAGCTGAGG + Intergenic
1186192721 X:7082186-7082208 CATCTCCAGGGGAAGAACTGGGG + Intronic
1187215994 X:17277015-17277037 ATCTTCCAGGTGAAAATCTGAGG + Intergenic
1187269636 X:17768196-17768218 TTCTTCCAGGGGAAAATGTGAGG + Intergenic
1192746606 X:73944759-73944781 CTGTTCCTAGGAAAGCTCTGAGG - Intergenic
1193070033 X:77297307-77297329 CCTTTCAATGGGAAGATCTGGGG + Intergenic
1194571487 X:95559317-95559339 CTGTTCCATGGGAAAAAATGTGG - Intergenic
1194623062 X:96196772-96196794 CTTTCCCAGGGAAAGATCAGAGG - Intergenic
1194926141 X:99826599-99826621 CAGTTCCAATGGAAGAACTGTGG + Intergenic
1195274564 X:103268940-103268962 ATGTTCCCAGGGAAGATCAGTGG - Intergenic
1195598170 X:106716697-106716719 ATGTGCCAGAGCAAGATCTGTGG + Intronic
1199753845 X:150846317-150846339 CTGTTCCAGGGCAACACATGAGG + Intronic
1201564562 Y:15352926-15352948 CCTCTCCAGGGGAAGAACTGGGG + Intergenic