ID: 1088672799

View in Genome Browser
Species Human (GRCh38)
Location 11:112159831-112159853
Sequence AATATCTAGGACAGAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088672790_1088672799 25 Left 1088672790 11:112159783-112159805 CCGTAGAACAGTTTGGGTAAAGT 0: 1
1: 0
2: 0
3: 4
4: 148
Right 1088672799 11:112159831-112159853 AATATCTAGGACAGAATGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088672799 Original CRISPR AATATCTAGGACAGAATGGG AGG Intronic
902402204 1:16164335-16164357 AATTTGTAGGACAGACTAGGGGG - Intergenic
904010719 1:27388662-27388684 GACATCTAGGCCAGAATGGAAGG + Intergenic
905124162 1:35705612-35705634 ATGCTCTAGGACAGGATGGGAGG - Intergenic
905343546 1:37295705-37295727 AAAACCAAGGACAGAGTGGGAGG + Intergenic
905648061 1:39638488-39638510 ACTCTCTAGAACAGAATTGGAGG - Intronic
909119418 1:71582334-71582356 AATATTTTGGAAAGAAAGGGAGG + Intronic
910047336 1:82933354-82933376 AAGATTTGGGACAGGATGGGTGG + Intergenic
911872836 1:103120720-103120742 AACATCTTTGACAGAATTGGAGG - Intergenic
915774733 1:158470698-158470720 AATCTATAGGACACAATGGGTGG - Intergenic
920713191 1:208315226-208315248 AGATTCTAGCACAGAATGGGTGG + Intergenic
924298519 1:242613084-242613106 AAGATCGTGGAGAGAATGGGTGG + Intergenic
1065300368 10:24315591-24315613 AATATCTAGGCCAGGAGTGGTGG + Intronic
1065647777 10:27854336-27854358 AATACCTAGGAGTGAATGGCTGG - Intronic
1065823324 10:29546701-29546723 AATATTTAGGACACTATTGGTGG + Intronic
1067468946 10:46522560-46522582 AATAAAACGGACAGAATGGGAGG - Intergenic
1068003881 10:51370077-51370099 AATATCAAGGTCAGAGTGGCTGG + Intronic
1071427857 10:85577309-85577331 AATATCTCTGGCAGAAGGGGTGG + Intergenic
1071461756 10:85903458-85903480 ATTATCTAGGAAAGGAAGGGTGG - Intronic
1072284690 10:93902867-93902889 AATATCTAGAAAAGCTTGGGAGG + Intronic
1072717953 10:97763983-97764005 AATATCAAGGCCATGATGGGTGG - Intergenic
1076029001 10:127141991-127142013 AAGATCTTGGATAGAATGGGTGG + Intronic
1078151287 11:8761605-8761627 GATATTTAAGAAAGAATGGGGGG - Intronic
1080340715 11:31260465-31260487 AATATTTTGGACAGAATTGCTGG + Intronic
1080537533 11:33236481-33236503 AGTATCTAGGCCAGACTTGGTGG - Intergenic
1082675638 11:56098512-56098534 AATAACTAGTATAGAATGGCTGG + Intergenic
1084792399 11:71482821-71482843 AACCACCAGGACAGAATGGGTGG - Intronic
1085376396 11:76066242-76066264 AACATCTAAGACAGACTGGAAGG - Intronic
1087923232 11:103890708-103890730 AATATTGAGGACAGTATGGAAGG - Intergenic
1088529484 11:110793068-110793090 AATATCAAGGACAGCAGAGGGGG + Intergenic
1088672799 11:112159831-112159853 AATATCTAGGACAGAATGGGAGG + Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1089211023 11:116802590-116802612 GACATGGAGGACAGAATGGGAGG + Intergenic
1090368834 11:126231802-126231824 AATTTCCAGGACAAAATGGTAGG + Intronic
1095678422 12:44946851-44946873 AATATCCTGGACAGACTGGATGG - Intergenic
1096466854 12:51851444-51851466 AAGATCTGGGAAAGAATGGAGGG - Intergenic
1097894673 12:64812981-64813003 AATTTCTAGGTCAAATTGGGTGG + Intronic
1098619669 12:72579472-72579494 AATATATAGGAAAGAATAGTAGG - Intronic
1098751740 12:74301540-74301562 AATATCTAGGCAAAAATGTGAGG - Intergenic
1099819800 12:87695500-87695522 CATATCTTGGATAGAAGGGGAGG - Intergenic
1100044317 12:90359877-90359899 AATAAAAAGGACATAATGGGTGG - Intergenic
1100419797 12:94421995-94422017 AATATCTAGGCCAAAAGGTGGGG - Intronic
1103685095 12:122725984-122726006 AATATCTAGAACTGCATGGCAGG - Intergenic
1107836513 13:44416217-44416239 AATATTTAGGAATGAAAGGGTGG - Intergenic
1111309233 13:86459461-86459483 AATATATGGGACAATATGGGTGG + Intergenic
1112535604 13:100252114-100252136 AAGAACTAGGACAGAAAGGAAGG - Intronic
1115380713 14:32735673-32735695 AAGATCCAGGACACAATGGCAGG + Exonic
1116647273 14:47544750-47544772 ATTATCTAGTACAGACTGGATGG - Intronic
1119645809 14:76347477-76347499 AACACTTAGCACAGAATGGGGGG + Intronic
1120276931 14:82387703-82387725 AGTATGTAGGACAGAATGTGAGG + Intergenic
1122212629 14:100182526-100182548 AATATCTAGGATGGAATTGGAGG - Intergenic
1122493771 14:102137617-102137639 AATAACTAGGCCTGAATGGCTGG - Intronic
1123773137 15:23549186-23549208 AATATCCAGGACAGCAAGTGTGG - Intergenic
1124365389 15:29067499-29067521 AAGACCTAGGAGAGAAGGGGAGG - Intronic
1124476191 15:30037156-30037178 AATATTTAAGACAGAAAGAGAGG + Intergenic
1124963266 15:34413831-34413853 AAGACCTAGGAGAGAAGGGGAGG - Intronic
1124979886 15:34560057-34560079 AAGACCTAGGAGAGAAGGGGAGG - Intronic
1125616776 15:41021438-41021460 AATATCTAGCAGTGAAGGGGAGG - Intronic
1127197748 15:56608044-56608066 AAAATGTAGGGCAGGATGGGGGG + Intergenic
1127516738 15:59701796-59701818 ATTAACAAGGACAGAAAGGGAGG - Intergenic
1130211123 15:81923403-81923425 AATATGTAGGACAGATGTGGTGG + Intergenic
1130267085 15:82416176-82416198 GGTATCTAGGAAAGAATGAGGGG + Intergenic
1131998563 15:98157237-98157259 AATATCTAAGAAAGAATGAGAGG + Intergenic
1135504665 16:23026061-23026083 TAAATCCAGGACAGAATTGGTGG + Intergenic
1137439759 16:48488321-48488343 AATATTTAAGAGAGAATGGGAGG - Intergenic
1139557386 16:67721025-67721047 AAGATTTAGGAGAGAATTGGAGG - Intergenic
1145127342 17:20313119-20313141 AACATCCAGGCCAGAAAGGGAGG - Intronic
1148252351 17:46094742-46094764 AATATCTATACCAGATTGGGGGG + Intronic
1149385280 17:56137027-56137049 AACATCTACTACAGATTGGGTGG + Intronic
1149825235 17:59822136-59822158 ATTATCTAGAAAAGAATGGCCGG - Intronic
1152983174 18:297793-297815 AACATCTGGAACATAATGGGGGG + Intergenic
1153378852 18:4412833-4412855 ATTATCCAGGACAGAGTGTGGGG - Intronic
1154474112 18:14736303-14736325 AATATATAGTAGAGAAAGGGTGG - Intronic
1156402488 18:36752383-36752405 ACTGTCTAGCCCAGAATGGGAGG - Intronic
1157757509 18:50231851-50231873 AACATCTGGGACAGAATGGCTGG - Intronic
1159320476 18:66840725-66840747 AATAGCCAGGAGAGATTGGGGGG + Intergenic
1162273544 19:9635595-9635617 AACAGCTAGAACAGAATGGTGGG + Intronic
1163580210 19:18134506-18134528 AAGGTCTAGGGCAGAAGGGGAGG + Intronic
1164422022 19:28102527-28102549 AATATCTACAACAAACTGGGTGG + Intergenic
927373037 2:22379766-22379788 AATGTCTAGGAGAGACTGGAGGG - Intergenic
932149558 2:69357288-69357310 AATATCAAGGTCAGAAAGAGTGG - Intronic
933582155 2:84139657-84139679 AAAATCCAGATCAGAATGGGTGG + Intergenic
937404355 2:121612750-121612772 TATATTTAAGACACAATGGGAGG + Intronic
939331000 2:140760939-140760961 AATATCTAAGAAAGGATGGATGG - Intronic
939743476 2:145939026-145939048 AGTATCAGAGACAGAATGGGAGG + Intergenic
940325987 2:152425350-152425372 AATCACCAGGACAGAATGGAGGG - Intronic
941379430 2:164775243-164775265 AAGATATAGGACAGTGTGGGTGG - Intronic
941600632 2:167538936-167538958 AATATTTATCACAGAATGTGAGG - Intergenic
944405929 2:199383572-199383594 ATAATATATGACAGAATGGGGGG + Intronic
945662220 2:212700522-212700544 TATCACTAGGACAGCATGGGGGG - Intergenic
1170933935 20:20793648-20793670 AATTACCATGACAGAATGGGTGG - Intergenic
1173153241 20:40585660-40585682 AATATAAAGGAAAGAATTGGAGG + Intergenic
1173433650 20:43013518-43013540 AATAGCTAAGACAGAAAGTGGGG + Intronic
1175058446 20:56219504-56219526 CATATTTAGGATAGAATGGGAGG + Intergenic
1175377241 20:58536623-58536645 AAAGTCACGGACAGAATGGGAGG + Intergenic
1177124365 21:17177874-17177896 AATTTCCAGGGCAGAATTGGTGG + Intergenic
1177619671 21:23570966-23570988 AATATGTAAGACAGACTGGGAGG - Intergenic
1180916163 22:19488917-19488939 AATATCACGGTCAGGATGGGAGG + Intronic
1183232837 22:36593565-36593587 TAGAGCAAGGACAGAATGGGGGG + Intronic
1183641448 22:39095372-39095394 AACATTTAGGACAGATAGGGTGG + Intergenic
1185033205 22:48456549-48456571 AATATGTAGGACAGGCTGGCAGG - Intergenic
949636293 3:5984943-5984965 ATCATCTAGAACAGAATGGGAGG - Intergenic
950178765 3:10896126-10896148 CATTTCTGGGACAGAATGAGTGG + Intronic
951035605 3:17928576-17928598 AATATGTAGGAAAAATTGGGAGG + Intronic
951139069 3:19140251-19140273 AAGATATAGGACAGAAGGGGAGG + Intergenic
951142630 3:19182802-19182824 AATAACAAGAACAGAATGGTCGG + Intronic
951418216 3:22450746-22450768 AGTAGCTAGGACAGCAGGGGTGG - Intergenic
953329406 3:42039758-42039780 TATATCTAGGACAAAATTGTTGG + Intronic
953604086 3:44397639-44397661 AATACCTAGAATAGAATGGCTGG + Intronic
953716851 3:45322978-45323000 AATTTCTTGCAGAGAATGGGGGG - Intergenic
955406083 3:58626753-58626775 CATCTCTAGGACAGACTCGGGGG - Intronic
958759840 3:98293735-98293757 AATATCTTGTCCAAAATGGGGGG - Intergenic
958863629 3:99473743-99473765 AATAGCTAAAACAGAAAGGGCGG - Intergenic
960059466 3:113305462-113305484 AATGTCTTTGACAGAATGGTGGG + Intronic
964236973 3:154542852-154542874 TATGTCAAGGACAGAATGTGAGG - Intergenic
964385142 3:156139327-156139349 AATTTGGAGGACAGAATGAGAGG + Intronic
966541169 3:181091381-181091403 AATATCTCTCACAGAATGTGAGG - Intergenic
969172283 4:5373719-5373741 AAGATCTGGGACAAAATCGGTGG - Intronic
971505052 4:27357720-27357742 AATATCTAAGACTGATTGTGAGG - Intergenic
973762426 4:54131288-54131310 AATTTCTAGGAGAGAATTGTAGG + Intronic
975242596 4:72079549-72079571 AATATCTAGAATAAAATAGGAGG + Intronic
977536794 4:98262671-98262693 AATAACTCGCACAGAAGGGGTGG - Intronic
979107086 4:116702787-116702809 CATATCTGGGAGAGAATGGAGGG - Intergenic
979972873 4:127159329-127159351 AGTACCAAGGAAAGAATGGGAGG + Intergenic
981675271 4:147336059-147336081 AATTTCTGGGACAAAATGGAAGG - Intergenic
982184602 4:152782713-152782735 AATATCTCATACAGAATGGAGGG - Intronic
988215275 5:28263884-28263906 AATACCTAAGACAGAGCGGGAGG - Intergenic
989208050 5:38831130-38831152 TATAGGTAGGAAAGAATGGGGGG - Intergenic
989233075 5:39109435-39109457 AATTTTAAGGACAGAATGTGTGG - Intronic
989347173 5:40442000-40442022 TATAACAAGGACAGACTGGGAGG + Intergenic
989695590 5:44196812-44196834 ATTATTTAATACAGAATGGGAGG - Intergenic
990370392 5:55112433-55112455 AGTATCCAGAACAGAATGGCAGG + Intergenic
991947291 5:71911578-71911600 AATATTTAAGACAGAATCTGAGG + Intergenic
993714643 5:91263775-91263797 AATATCTAGGAGAAAATGGCTGG - Intergenic
995949481 5:117692768-117692790 ATTATATAGGCCAGAATGTGAGG + Intergenic
996244154 5:121239317-121239339 AAAATCCAAGACAGACTGGGAGG - Intergenic
996689711 5:126327254-126327276 GATGTCTGGGACAGACTGGGTGG + Intergenic
997023179 5:130026166-130026188 AATTTCAAGGAAAGAAAGGGTGG - Intronic
999289755 5:150416477-150416499 AAAATCTAGGCCAGAAATGGTGG + Intergenic
1001905394 5:175468145-175468167 AATTTCCAGGACATAGTGGGAGG + Intergenic
1006222491 6:32504382-32504404 AATTTCTAGGACAAAATAGAAGG - Intergenic
1007197341 6:40074061-40074083 AATTTCCTGGACAGAATTGGGGG - Intergenic
1007304348 6:40892450-40892472 ATGAGCTAGGAAAGAATGGGAGG + Intergenic
1009364166 6:62845186-62845208 AATATCCAGGAGAGAAAGGATGG - Intergenic
1009654756 6:66527324-66527346 TATCATTAGGACAGAATGGGGGG + Intergenic
1009716620 6:67405799-67405821 GATTTCTCGGACAGAATAGGAGG + Intergenic
1011124900 6:83996463-83996485 AATATCTAGGAGAGTAATGGTGG - Intergenic
1011206040 6:84899382-84899404 AATATCTGGAATAGAATGGTTGG + Intergenic
1012262352 6:97102309-97102331 AGTAGCTAGGAAACAATGGGGGG + Intronic
1013595275 6:111655097-111655119 AACATCTAGCTCAGAATGGGGGG - Intergenic
1015263395 6:131263989-131264011 AATAGCAAGTAAAGAATGGGGGG - Intronic
1018571102 6:165210824-165210846 AATATCTAGGAGAGAGTGGTTGG - Intergenic
1018777480 6:167030979-167031001 AATTTGGGGGACAGAATGGGTGG - Intronic
1020595640 7:10204215-10204237 AATATCTAGCACAAAGTAGGTGG - Intergenic
1022951701 7:35345275-35345297 AATATCTAGGAATGAATTTGTGG - Intergenic
1023615532 7:42015937-42015959 AATATTTAGGGCAGAACTGGGGG + Intronic
1025489068 7:61088958-61088980 AATATCTCAAAAAGAATGGGTGG - Intergenic
1026341782 7:69440476-69440498 ATTAGCTAGGCCAAAATGGGGGG + Intergenic
1027788802 7:82613737-82613759 AAAATCTATGACAGATTGGGTGG + Intergenic
1028140622 7:87270813-87270835 AATACCCAGGACAGAATTGCTGG + Intergenic
1028295343 7:89122944-89122966 AATAGCCAGGACAGATTAGGCGG - Intronic
1030784526 7:113643681-113643703 AATAGATAGGATAGAATAGGAGG + Intergenic
1032998315 7:137474472-137474494 AAGATCCAAGACAGAATAGGAGG + Intronic
1034179703 7:149127214-149127236 CATGACTAGGACAGAATGCGAGG - Intronic
1034939224 7:155219543-155219565 AATACCTAGCTCAGAGTGGGAGG - Intergenic
1036978751 8:13444946-13444968 AAGATGTAGGAAAGAAAGGGAGG + Intronic
1040685322 8:49864815-49864837 AATATATAAGACCCAATGGGTGG - Intergenic
1041517403 8:58715671-58715693 AATATCCTGGACAGAAAGTGAGG + Intergenic
1043052871 8:75404652-75404674 CAAATCTAGAAAAGAATGGGAGG + Intergenic
1043750031 8:83923160-83923182 AATAGCTAGAACAGAATGATTGG - Intergenic
1045029126 8:98118108-98118130 AGTATGTAGGACAAAATGAGAGG - Intronic
1045176759 8:99733580-99733602 AAAATCTAGGACAGAACAAGAGG - Intronic
1050537197 9:6641175-6641197 CATGTATAGGACAGAATGGCCGG - Intronic
1051209953 9:14730757-14730779 CAAATGTAGGACAGAATGTGAGG + Intergenic
1051381026 9:16458697-16458719 AATATGTATTACAGAAAGGGAGG + Intronic
1055623455 9:78149604-78149626 AATAACTACTACAGAATGTGAGG + Intergenic
1055885384 9:81056889-81056911 AATCTGTAGGACAGACTGGCAGG - Intergenic
1057487530 9:95497680-95497702 AAAATGTGGGACAGAATGGAGGG - Intronic
1059680847 9:116584152-116584174 AGGAGCTAGGAGAGAATGGGTGG + Intronic
1061627157 9:131847559-131847581 AACAGATAGGACAGACTGGGGGG - Intergenic
1187673663 X:21693693-21693715 AAAATCTAGGCCCGAAAGGGTGG + Intergenic
1188607185 X:32045595-32045617 AGTATCAAGGACAGACGGGGAGG - Intronic
1189682299 X:43529254-43529276 AATATCTATGAAGGAAAGGGAGG - Intergenic