ID: 1088673685

View in Genome Browser
Species Human (GRCh38)
Location 11:112168971-112168993
Sequence CAGATAATACAGGACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088673685 Original CRISPR CAGATAATACAGGACCTTGA AGG Intronic
902954873 1:19918742-19918764 CACAGCATTCAGGACCTTGAGGG - Intergenic
903918844 1:26785139-26785161 CAGATAAGATAGGAATTTGATGG + Intergenic
904799090 1:33080478-33080500 GACATTATACAGGACTTTGATGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905726235 1:40254106-40254128 CAGGTAATGAAGGACCTCGAAGG + Intergenic
906100292 1:43255975-43255997 CAGATTGTGCAGGACCGTGAAGG + Intronic
906739083 1:48163472-48163494 GAGATAATGCAGGATATTGAAGG + Intergenic
906784017 1:48598116-48598138 CAGATCACACAGGGCCTTGAAGG + Intronic
908004803 1:59716942-59716964 CAGATTCTACAGGATTTTGAAGG + Intronic
909622884 1:77686515-77686537 CAAATAAAACAGGACCTGGGAGG + Intergenic
910110101 1:83673823-83673845 GAGATAATTTAGGACCTTCAAGG + Intergenic
910667562 1:89741506-89741528 CAGACAATGCAGTACCTGGAGGG + Intronic
911012439 1:93295611-93295633 TAGACAACACAGGACCTAGAAGG - Intergenic
911451253 1:98063956-98063978 CAGAAAATACAGAGTCTTGAAGG - Intergenic
912565763 1:110586108-110586130 CAGATTGTATAGGACCTTGTAGG - Intergenic
912734458 1:112137815-112137837 TAGATTATAAAAGACCTTGAAGG - Intergenic
912734503 1:112138271-112138293 TAGATTATAAAGGACCTTGAAGG - Intergenic
915837099 1:159186249-159186271 CAGACTGTACAGGACCTTGAAGG + Intronic
916661627 1:166927116-166927138 AACATAGTACAGGACCTTCATGG + Exonic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
918433525 1:184486927-184486949 CAGACAATACAAGCACTTGAAGG - Intronic
919436665 1:197571310-197571332 CAGATCATACAAGGCTTTGAAGG - Intronic
919754315 1:201057158-201057180 CAGATCATCTAGGCCCTTGAAGG - Intronic
921124477 1:212164883-212164905 TAGATTAAACAGGACCTTGAAGG - Intergenic
921391026 1:214613806-214613828 CAGAAAATTCAAGAGCTTGAAGG + Exonic
921515651 1:216087985-216088007 CAGATTATATGGGACCTTGTGGG - Intronic
921813807 1:219544466-219544488 CAGACCATAAAGGACCTTGTAGG + Intergenic
922366708 1:224872039-224872061 CAGATTCTGCAGGGCCTTGAAGG + Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
923543624 1:234908099-234908121 CAAATAATGCAGGATCTTTATGG + Intergenic
924173995 1:241370917-241370939 CAGATAATTTAGGGTCTTGAAGG - Intergenic
1063955898 10:11266670-11266692 CAGATGATACAGTACCTCCATGG - Exonic
1066253642 10:33657410-33657432 CAGATTATAATGGACTTTGATGG - Intergenic
1067276175 10:44836264-44836286 CACATAATACATGAACTGGAAGG + Intergenic
1069573152 10:69506708-69506730 CAGGTCACACAGGACCATGAGGG + Intronic
1069796295 10:71053783-71053805 CAGCTAATCCTTGACCTTGAGGG + Intergenic
1070112900 10:73501675-73501697 CATATCACACAGGACCTTGTAGG - Intronic
1071437027 10:85656988-85657010 CAGATAACATAGGACCTTTCAGG - Intronic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1076272765 10:129169196-129169218 CAGAGAATACAGGGCTGTGAGGG + Intergenic
1081296970 11:41403122-41403144 CAGATAATTGAGGATTTTGAAGG + Intronic
1081470811 11:43368800-43368822 TAGATCTTACAGGACCTTGTAGG - Intronic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082749275 11:56999834-56999856 CAGATAATTCTGGAAATTGAAGG - Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1086286407 11:85256415-85256437 CAGGTAATACATGGACTTGAAGG - Intronic
1086835391 11:91614755-91614777 CAGATACTACAGGACTCTGCTGG - Intergenic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1089430638 11:118421549-118421571 CAGATAATAAAGAATCTCGAAGG + Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091704277 12:2683461-2683483 CAGATGAGACAGGGCTTTGAGGG - Intronic
1092634698 12:10430475-10430497 AAGATAACACAGTACATTGAAGG + Intronic
1092635738 12:10445904-10445926 AAGATAACACAGTACATTGAAGG + Intronic
1093255899 12:16867801-16867823 CAGAGAAAACAGCACCTGGATGG - Intergenic
1093655019 12:21684589-21684611 CAGGTTATACAGGTCCTTGTAGG + Intronic
1097970727 12:65630194-65630216 CAGATGCTGCGGGACCTTGAGGG + Intergenic
1098641938 12:72849525-72849547 CAGATAATACAGGACCTTGTAGG + Intergenic
1098646651 12:72910207-72910229 CAGATGGTAAAGGACCTTGTGGG + Intergenic
1099203363 12:79700875-79700897 CAGATCATACAGGGTCTTAAAGG - Intergenic
1099307168 12:80971665-80971687 CAGCTAAAACAGGTCCTGGATGG - Intronic
1099318679 12:81117621-81117643 CAGATCATATAGAACCTTGCAGG + Intronic
1099372647 12:81856320-81856342 CTGATCATACAGGAACTTGTAGG + Intergenic
1099830572 12:87837520-87837542 CAGATCATAAACAACCTTGATGG + Intergenic
1100131000 12:91493232-91493254 TAGATAATACAAGTCCTTAAAGG - Intergenic
1101001341 12:100361235-100361257 TAGATCACAGAGGACCTTGAAGG - Intronic
1102114209 12:110389175-110389197 CAGATATTACTGGGCCTTGTGGG - Intronic
1102559008 12:113748863-113748885 CAGAAAAAGCATGACCTTGAAGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106929243 13:34646089-34646111 CAGATTATGGAGAACCTTGACGG + Intergenic
1108845932 13:54678526-54678548 CAGATCATACAGGAGGGTGAGGG - Intergenic
1108994973 13:56718723-56718745 CAGATCATATATGACCTTGTAGG + Intergenic
1109339931 13:61043120-61043142 GAGATCATTCAGGACATTGAAGG + Intergenic
1109482119 13:62969587-62969609 CAGGTTATACAGGACCTTGAAGG - Intergenic
1110391942 13:74984256-74984278 AAGATCATAGAGGGCCTTGAGGG - Intergenic
1110658000 13:78023525-78023547 CAGATTACAAAGGACCTTGTGGG + Intergenic
1111073422 13:83200127-83200149 CAGTTCACACAGGGCCTTGAAGG - Intergenic
1111908956 13:94288493-94288515 CAGATAATGCAAGAGCTTGCAGG - Intronic
1112398703 13:99057097-99057119 GAGATAAGAGAGGATCTTGAAGG + Intronic
1115254953 14:31390231-31390253 CAGAAGATATAGGACCTTGTAGG + Intronic
1115775164 14:36706993-36707015 CAGATCATACTGGCCCTTGTAGG - Intronic
1116578105 14:46601910-46601932 CCAGTAATACAGGACCTTGCAGG + Intergenic
1116901523 14:50366457-50366479 CAGATCCTACAGGGCCTTGCAGG + Intronic
1117128623 14:52660652-52660674 CAGAAAATAGAGGATTTTGAGGG + Intronic
1119381628 14:74232910-74232932 CAGAGAGCACATGACCTTGAGGG - Intergenic
1120042223 14:79767142-79767164 CAGATTGTACTGGACCTTGTAGG - Intronic
1120256303 14:82123789-82123811 CAGATAAAAAAGAAGCTTGAGGG + Intergenic
1120489118 14:85154177-85154199 CATATAATACATAACCTTGTTGG + Intergenic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1127120103 15:55764509-55764531 CAGAGAGTAGAGGACCATGAAGG + Intergenic
1129085278 15:73083072-73083094 CAAATAATTCAGGGCCTTGTTGG + Intronic
1129138803 15:73578153-73578175 CAGATTAGACAGGACTTTGTAGG + Intronic
1130358684 15:83159852-83159874 CAGATTATTTAGGGCCTTGAAGG + Intronic
1130705333 15:86227838-86227860 CAGATTCTACAGGATCTTGAGGG + Intronic
1130898942 15:88192627-88192649 CAGCTTGTGCAGGACCTTGAGGG - Intronic
1135064842 16:19300730-19300752 CAGATAATATAGGAAAGTGATGG + Intronic
1135387654 16:22058019-22058041 CAGGTAATACAGGACCTGGTAGG + Intronic
1137435075 16:48448249-48448271 CAGGTAATGGTGGACCTTGAGGG - Intronic
1137964167 16:52914377-52914399 CAGATCACACATGAGCTTGAAGG - Intergenic
1137989207 16:53135240-53135262 CAGATTATACAGGGCCTTGTGGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138369742 16:56517290-56517312 CAGATCATATAGGAACTTGTAGG - Intronic
1139909453 16:70388405-70388427 CAGAAGGTCCAGGACCTTGAAGG + Exonic
1140015747 16:71182190-71182212 TAGATGGTACAGGACCTTGGAGG + Intronic
1140101226 16:71919190-71919212 CAGACAATGCAGGACCATGTAGG - Intronic
1142986567 17:3698615-3698637 CAGTTAAGACAGGACATGGAGGG - Intergenic
1144441959 17:15291827-15291849 CAGATAACACAGGAATTTAAGGG - Intergenic
1146576279 17:33994692-33994714 TAGATACCACTGGACCTTGAGGG - Intronic
1148248686 17:46054621-46054643 CAAATACTATAGGACCTTGTGGG - Intronic
1150319284 17:64197892-64197914 CAGGTAATACAGTGCCTAGAGGG - Intronic
1150500889 17:65649994-65650016 CAGACAGTACAGGGCCTTGTTGG - Intronic
1150577435 17:66442555-66442577 CTGATGATACAGGGCCTTGTAGG - Intronic
1152873614 17:82772899-82772921 CAGTTAATACAGGACGTTGGGGG - Intronic
1153165857 18:2261588-2261610 CAGACCATACAGGACTTTGTGGG - Intergenic
1154388467 18:13916632-13916654 CAGATAATACAGTAGCTTTCTGG - Intergenic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1156145473 18:34171004-34171026 CAGATAGAACATGACTTTGAGGG + Intronic
1156201175 18:34834095-34834117 GTGATAATATAGCACCTTGAAGG + Intronic
1156294143 18:35774635-35774657 CAGATGATACAGGGCCTTCTAGG - Intergenic
1157505643 18:48224426-48224448 CACAGAATAGAGGCCCTTGAGGG + Intronic
1160713016 19:561810-561832 CAGATAATACAGGCCCTGATGGG - Intergenic
1164518501 19:28957491-28957513 CATATATTACAGGAACATGAAGG - Intergenic
1165663187 19:37600821-37600843 CAGAGAATAAAGAAACTTGATGG - Intronic
1166039839 19:40195157-40195179 CAGATCACATAGGACCTTGGGGG + Intronic
1167204765 19:48093583-48093605 CAGATCATATGGGACCCTGAAGG - Intronic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
925052468 2:827647-827669 CAGCTAATACAGGTATTTGATGG + Intergenic
925800858 2:7599111-7599133 CAGTTACTACAGGACCCTCAAGG + Intergenic
926876187 2:17482181-17482203 CGGATAATATAGGATCATGATGG + Intergenic
928363814 2:30686564-30686586 CAGAAAACACAGGACCGTGCAGG + Intergenic
929369571 2:41206218-41206240 CAGAAAATACAAGGCCTTGAAGG + Intergenic
929642355 2:43594631-43594653 CAGATTATTTAGGGCCTTGAAGG - Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930282340 2:49385436-49385458 TAGATCATATAGGATCTTGAGGG - Intergenic
930886598 2:56333458-56333480 CAGATCACACAGGGCCCTGATGG + Intronic
930945755 2:57073130-57073152 CAGGTAATACAGGAAATGGAGGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931339211 2:61382280-61382302 CAGATTATTCAGGACCTTGTAGG - Intronic
931648195 2:64444430-64444452 CAGCTCCTACAGGGCCTTGAAGG + Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933075135 2:77914911-77914933 CAGATAATATAGGACCTATTTGG + Intergenic
933225227 2:79740519-79740541 CAGATATTACAGGGCATTGCAGG + Intronic
935641860 2:105298510-105298532 CATATCCTACAGGACTTTGAAGG - Exonic
939399129 2:141668678-141668700 CAGATTATACATGGACTTGAAGG - Intronic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
941801916 2:169669325-169669347 CAGATCATACAGAGCCTTGGAGG + Intronic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
942842077 2:180374183-180374205 CAGGTTGTACAGGACCATGATGG - Intergenic
942866557 2:180682912-180682934 GAGATAATAAAGTACCTTGCAGG - Intergenic
943626824 2:190210620-190210642 CAGAGCATACAGAGCCTTGAAGG - Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
945446596 2:209945586-209945608 CAGATAATAGAAGACACTGAAGG - Intronic
945506823 2:210651995-210652017 GAGAAAATACAGGATGTTGAGGG + Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
947924728 2:233911370-233911392 CAGATTATATAGGACTTTGTAGG - Intergenic
948120880 2:235529590-235529612 CACAAAATCCAGGACCTGGAAGG + Intronic
1168958152 20:1849054-1849076 CAGATCACACAGGGCCTTGAAGG - Intergenic
1169298688 20:4423124-4423146 CAGATAATAGAGGACCTGCTTGG - Intergenic
1171857440 20:30360174-30360196 CAGATAATACAGGATTTTCAAGG + Intergenic
1172270377 20:33652095-33652117 AAGATAATTAAGGACCTTCAGGG + Intergenic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172836866 20:37878717-37878739 CGGATCTTACAGGGCCTTGAGGG + Intergenic
1173829558 20:46072540-46072562 AAGATTATACAGGACCTTCATGG - Intronic
1174201341 20:48808690-48808712 CAGATTGCACAGGGCCTTGAGGG - Intronic
1174277371 20:49413752-49413774 CAGATCAGACAGGGTCTTGAAGG - Intronic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177922371 21:27168712-27168734 CAGATCATATAGTACCTTGTGGG - Intergenic
1178455153 21:32742323-32742345 CAGATGATAGAGGATCTTGTAGG - Intronic
1182147182 22:28003788-28003810 CAGAGAATGCATGTCCTTGAAGG + Intronic
1184501365 22:44875729-44875751 CAGTTAAAACAGTACCTGGAGGG + Intergenic
1184617395 22:45647285-45647307 CATATCATTCAGGACCTTCATGG - Intergenic
1185045027 22:48524469-48524491 CAGTCAAAACAGGACCTTGGTGG + Intronic
950201657 3:11048682-11048704 CAGATCAGACAGGGCCTTGCAGG - Intergenic
950699813 3:14734349-14734371 CAGCTAAAACTGGACTTTGAGGG - Intronic
951100137 3:18677974-18677996 CAGATAACATAGGGCCTTAAAGG - Intergenic
952279339 3:31908203-31908225 CAGATCACACAGAACCTTGCAGG + Intronic
952845297 3:37683080-37683102 CAGATCCCACAGGGCCTTGAGGG - Intronic
953070064 3:39511321-39511343 CAGATAATTCAGGGCCATGTAGG - Intronic
955860449 3:63324348-63324370 CAGACAATAAAGAGCCTTGAAGG + Intronic
957127514 3:76180842-76180864 CAGAAAATTCAGGGCCTTGTAGG - Intronic
957534860 3:81488461-81488483 CACAGAATAGAGGACCTTTATGG - Intergenic
957722591 3:84023283-84023305 CAGATAATACAATACTTTGAGGG - Intergenic
958662341 3:97087250-97087272 CAGTCACTAGAGGACCTTGATGG + Intronic
958915388 3:100044612-100044634 CAGATTATACAGGGCCTTATAGG + Intronic
959353143 3:105293706-105293728 CAGTTAACACAGGAACTTGTGGG + Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960837389 3:121920594-121920616 CAGATAAAAAAGTACCTAGACGG - Intronic
961697012 3:128712412-128712434 CAGATAGTGCAGGGCCTTGAAGG + Intergenic
964625773 3:158758016-158758038 CAGGTAATGCAGAACCTAGAGGG - Intronic
965846485 3:172968247-172968269 CAGATCATACAAGAATTTGAGGG - Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966166773 3:177028361-177028383 AAGATACTACAAGACATTGAAGG - Intronic
966346479 3:178986393-178986415 CAGACAAAACAGGACCAGGAAGG + Intergenic
967255422 3:187587138-187587160 TAGATAACACAGTATCTTGAAGG - Intergenic
967861639 3:194156330-194156352 CAGTTCACACAGGGCCTTGAAGG + Intergenic
967861645 3:194156363-194156385 CAGTTCACACAGGGCCTTGAAGG + Intergenic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
970854689 4:20638183-20638205 CAGAGACTGCAGGATCTTGAAGG - Intergenic
970881411 4:20936663-20936685 CAAATAATACAGGAGAATGAAGG - Intronic
971130557 4:23804617-23804639 CAGACCATACAGGGCCTTGTAGG - Intronic
971863654 4:32141015-32141037 GAGATTATACAGGAGATTGAAGG - Intergenic
972625844 4:40797810-40797832 CAGATAGTACAGGGACTTGTGGG - Intronic
974125075 4:57686102-57686124 CAGATAGTGCAGGGCCTTGAAGG - Intergenic
974360425 4:60871166-60871188 GAGATAATACAGAACTTTTAGGG - Intergenic
975430858 4:74289339-74289361 CAGCAAATGCAAGACCTTGAGGG + Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976585301 4:86790760-86790782 CAGATAATTCAGGGCCTTCAAGG + Intronic
978103051 4:104866815-104866837 CAGATCATACAGGTCCTTGTAGG - Intergenic
980191504 4:129530557-129530579 AAGATTACACAGGACCTTGAAGG - Intergenic
980546295 4:134267471-134267493 CAGATAAGACAAGACCATGTAGG + Intergenic
980600680 4:135020223-135020245 TAGATAATACATGAACTGGATGG + Intergenic
981286472 4:143024718-143024740 AAGATAATCCAATACCTTGAAGG + Intergenic
981610323 4:146587157-146587179 CAGATCATATAGGATCTTAAAGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
982609377 4:157554131-157554153 CAGGAAATACAGGACCTGGGGGG - Intergenic
983078539 4:163355810-163355832 CAGATGACACAGGTCCTTGTAGG + Intergenic
987150211 5:15031204-15031226 CAGACTATGGAGGACCTTGAAGG - Intergenic
987697259 5:21348385-21348407 CATAGAATACAGAACCTCGATGG - Intergenic
987960924 5:24807412-24807434 CAGATAATTCAGGGCCTTGAGGG + Intergenic
988168703 5:27627532-27627554 CAGACATTGTAGGACCTTGAAGG - Intergenic
988754981 5:34238307-34238329 CATAGAATACAGAACCTCGATGG + Intergenic
989541905 5:42627902-42627924 CAGATCATACAGGGGCTCGAAGG + Intronic
989807195 5:45624110-45624132 CAGATAATGCAGGACCTTATGGG + Intronic
991743193 5:69703991-69704013 CATAGAATACAGAACCTCGATGG + Intergenic
991754502 5:69851212-69851234 CATAGAATACAGAACCTCGATGG - Intergenic
991794766 5:70283727-70283749 CATAGAATACAGAACCTCGATGG + Intergenic
991804121 5:70407962-70407984 CATAGAATACAGAACCTCGATGG - Intergenic
991822581 5:70579302-70579324 CATAGAATACAGAACCTCGATGG + Intergenic
991833831 5:70726360-70726382 CATAGAATACAGAACCTCGATGG - Intergenic
991887144 5:71283265-71283287 CATAGAATACAGAACCTCGATGG + Intergenic
992881907 5:81118475-81118497 CAGACAAGATAGGACCTTGAGGG - Intronic
994669889 5:102753206-102753228 CAGACACACCAGGACCTTGAGGG + Intergenic
995123073 5:108555799-108555821 CGTATAATATAGGACCTTGAAGG + Intergenic
995438748 5:112166383-112166405 CAGATAACACAGGGACTTAAAGG - Intronic
995640843 5:114255546-114255568 CAGATAAGGCAGGGCCTTGTAGG + Intergenic
995982113 5:118117003-118117025 CAGATCATAAATGACCTTGTGGG + Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
998863058 5:146464389-146464411 CATATAAAACAGGAACTAGAAGG + Intronic
999254802 5:150204369-150204391 CAGATAAGACAAGGCCTAGAAGG + Intronic
999572147 5:152931303-152931325 CAGATTATACTGGAACTTGTAGG - Intergenic
1000990229 5:167904211-167904233 CAGCTAATCCAGCCCCTTGATGG - Intronic
1001017359 5:168153624-168153646 CAGATAATGCAGGGCCTTTGAGG + Intronic
1001376358 5:171262875-171262897 TAGCTAATACAGGATCATGAGGG - Intronic
1002123158 5:177021616-177021638 CAGATTGTACAGGGCCTTGTTGG + Intronic
1003394374 6:5740721-5740743 CACATTATCCAGGACATTGAAGG + Intronic
1003661531 6:8066641-8066663 GAGACAATACAAGACCTTCAGGG - Intronic
1005553602 6:26950018-26950040 CATAGAATACAGAACCTCGATGG + Intergenic
1005627861 6:27680369-27680391 CAGATTATCCAGGCCGTTGACGG + Intergenic
1005660200 6:27990511-27990533 CAAATCACACAGGACCATGAAGG + Intergenic
1006144317 6:31949217-31949239 CAGAAGAGACAGGACCATGAGGG - Intronic
1008890939 6:56489120-56489142 CAGACAAAATAGCACCTTGAAGG - Intronic
1009296869 6:61961780-61961802 AAAATCATACAGGGCCTTGAAGG + Intronic
1011656230 6:89554407-89554429 CAGATAATCCAGGACATCAACGG + Intronic
1012397032 6:98810453-98810475 CAGATCATACAGGGCATTGTAGG - Intergenic
1012649393 6:101734676-101734698 CAGATCCTACAGGGCCCTGAAGG + Intronic
1013439512 6:110148605-110148627 CAGATTAGGTAGGACCTTGAAGG + Intronic
1014368625 6:120577230-120577252 CAGATAACAAAGGACCTTGAAGG + Intergenic
1015209959 6:130685771-130685793 GAGATAATGAAGGACCTTGTAGG + Intergenic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015645171 6:135379675-135379697 CAGATTGTACAGAACCTTGTAGG - Intronic
1015809094 6:137143292-137143314 CAGATCATACAGCGCCTTGGAGG + Intergenic
1016329351 6:142940578-142940600 AAGGTAATGCAGGGCCTTGAAGG - Intronic
1016532658 6:145075466-145075488 CAGATTATACAGGACCTCATAGG + Intergenic
1016580436 6:145623570-145623592 CAGATTGTACAGGACCTCAAAGG + Intronic
1017321980 6:153105077-153105099 CAGATCACACTGGGCCTTGAGGG + Intronic
1021174241 7:17432182-17432204 CAGATATTAGAGGTCCTTAAAGG + Intergenic
1021669135 7:23017139-23017161 TAGATAATAGAACACCTTGAAGG + Intergenic
1021803204 7:24328772-24328794 CAGAAAATAAAGTTCCTTGAAGG - Intergenic
1021830367 7:24601548-24601570 CAGAGAATACAGGATCTAGAAGG - Intronic
1023143833 7:37129517-37129539 CAGATAATGCAGGTCTGTGAAGG - Intronic
1024367181 7:48534901-48534923 AATATAATACAGGACATGGAAGG - Intronic
1026091456 7:67303859-67303881 CATAAAAATCAGGACCTTGAGGG - Intergenic
1026114242 7:67482995-67483017 CAGATACTATAGGAACTTGCAGG - Intergenic
1026375526 7:69746721-69746743 CAGGTCATATAGGACCTTGTAGG + Intronic
1026823820 7:73568588-73568610 CAGGTTACACAGGACCTTGCAGG + Intergenic
1030069809 7:105688966-105688988 CAGAAAAGACAAGACCTTGGGGG + Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1031339680 7:120583710-120583732 GAGATATCAAAGGACCTTGAAGG - Intronic
1031509095 7:122626141-122626163 CAGATCACACAGGACTTTGCAGG + Intronic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1031618079 7:123904480-123904502 CAGAGAAGACAGGAACATGATGG - Intergenic
1032259019 7:130319664-130319686 CAGATATTACAGGAAGGTGAGGG + Intronic
1036598534 8:10238051-10238073 CAGATAGTGTAGGACCTTGTGGG - Intronic
1036733725 8:11288640-11288662 CAGAGAGTACAGGAAGTTGATGG + Intronic
1038734053 8:30153215-30153237 CAGAGAGGACAGAACCTTGAAGG - Intronic
1038892017 8:31736104-31736126 CAGATGATAAAGGGCATTGAAGG - Intronic
1041370634 8:57156542-57156564 AAGATAAAACAGGAGCTTGCAGG + Intergenic
1042037576 8:64552620-64552642 CAGACAAAACAGAATCTTGAGGG - Intergenic
1044843571 8:96358974-96358996 CAGAGAATAGAGAACATTGAAGG - Intergenic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1047890827 8:129306791-129306813 CTGAAAATACTGGACCCTGAGGG - Intergenic
1048535189 8:135287059-135287081 GAGATAATACAAGAACTTGAAGG + Intergenic
1048994203 8:139781489-139781511 CAGAGAATAGAGGACATTTAGGG + Intronic
1057208497 9:93186898-93186920 CAGAACCTACAGGACCATGAGGG - Intronic
1057785197 9:98082158-98082180 CAGATAATACAGGCAGATGAGGG - Intronic
1058381417 9:104381110-104381132 CAAATAGTACAGGACCTGCATGG + Intergenic
1058934184 9:109752648-109752670 CATATTATGAAGGACCTTGAAGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059820846 9:117970437-117970459 CAGATGTGACTGGACCTTGAGGG + Intergenic
1060617503 9:125031712-125031734 CAGGAAATATAGGACCTTTATGG - Intronic
1187202257 X:17146181-17146203 CAGATCGTACAGGGCCTTGTGGG - Intronic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188297450 X:28466989-28467011 AAGATAATACATGACCTACAGGG - Intergenic
1190702120 X:52996894-52996916 CAGATTATACAGGACCTTCTGGG + Intergenic
1192270997 X:69579307-69579329 CAGATAAAAAAGGACATTGTAGG - Intergenic
1194423601 X:93708314-93708336 CAGATCATATAGGACCTTATAGG + Intronic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195898587 X:109773607-109773629 CAGATCACACAGGGCCTTGTAGG + Intergenic
1196581481 X:117384112-117384134 CAAATTTTATAGGACCTTGAAGG - Intergenic
1196848785 X:119917956-119917978 CAGATCACACAGGGCCTTGTAGG - Intronic
1197812953 X:130464504-130464526 CAGAAAATACAGCTTCTTGAGGG + Intergenic
1198791548 X:140352344-140352366 CAGATCACACAGGGCCTTGTAGG + Intergenic
1199761990 X:150911993-150912015 CAGATATAACAAGACCTTGAGGG + Intergenic
1199778274 X:151034728-151034750 CAGATCCTATAGGACCTTGTGGG - Intergenic