ID: 1088679467

View in Genome Browser
Species Human (GRCh38)
Location 11:112226636-112226658
Sequence GCTGCTGGGGCGACGCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088679463_1088679467 -6 Left 1088679463 11:112226619-112226641 CCGGGAGGGGCGCGGGGGCTGCT 0: 1
1: 0
2: 6
3: 36
4: 342
Right 1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG 0: 1
1: 0
2: 1
3: 12
4: 142
1088679449_1088679467 29 Left 1088679449 11:112226584-112226606 CCGGGGCGGGGCCGGCGGGCGTG 0: 1
1: 2
2: 6
3: 68
4: 477
Right 1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG 0: 1
1: 0
2: 1
3: 12
4: 142
1088679462_1088679467 -5 Left 1088679462 11:112226618-112226640 CCCGGGAGGGGCGCGGGGGCTGC 0: 1
1: 1
2: 7
3: 95
4: 658
Right 1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG 0: 1
1: 0
2: 1
3: 12
4: 142
1088679451_1088679467 18 Left 1088679451 11:112226595-112226617 CCGGCGGGCGTGCTGACGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088679467 Original CRISPR GCTGCTGGGGCGACGCGCGC TGG Intronic
900126061 1:1069425-1069447 GCTCCTGAGGCGGCTCGCGCTGG - Intergenic
901012373 1:6209093-6209115 GCTGCGGGGGCGGCGGGCGGTGG - Exonic
901317397 1:8318233-8318255 CCTGCCGGGGCGCCGCGCCCTGG + Intronic
903233866 1:21937341-21937363 GCTGCGGGGGCGGGGCGGGCGGG - Intergenic
905912072 1:41662096-41662118 GCGGCGGGGGCGCGGCGCGCGGG + Intronic
906903609 1:49864857-49864879 GCTGCTGGGGCGAGGGGAGGCGG + Intronic
913300732 1:117366919-117366941 GCTGCTGGGCCGACACCCGTTGG - Intergenic
918423514 1:184386869-184386891 GCCGCCGGGGCGCAGCGCGCTGG - Intergenic
921945696 1:220884577-220884599 GCTGCTGGCGCAACCCGCACTGG - Exonic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
1063663164 10:8047585-8047607 GCTGCTGGGCTGACCCGAGCTGG + Intergenic
1065140532 10:22714655-22714677 GCGGCTGCGGCGCCGCGGGCGGG + Intergenic
1068982164 10:63073079-63073101 GCTGCTGTGGGGACACGGGCTGG + Intergenic
1069564054 10:69451513-69451535 GCAGGTGGGGCCACGAGCGCTGG + Exonic
1076726724 10:132417328-132417350 GCTGCTGCTGCCTCGCGCGCTGG + Exonic
1076999579 11:315948-315970 GCTGCTGGGCCGTGGCGAGCTGG - Intergenic
1078631644 11:13009340-13009362 GCTCCCGGGGCAACGCGCCCAGG - Intergenic
1079130569 11:17744701-17744723 GCTGCTGTGGGGAAGGGCGCAGG + Intronic
1083753688 11:64778047-64778069 GCTGCGGCGGCGACACGCGCTGG + Exonic
1088679467 11:112226636-112226658 GCTGCTGGGGCGACGCGCGCTGG + Intronic
1102025850 12:109714051-109714073 GCAGCAGGGGCCGCGCGCGCTGG - Intergenic
1103048777 12:117761234-117761256 GCTGCCGGGGCGATGGGGGCAGG + Exonic
1104602421 12:130162547-130162569 GCTGTGGGGGCGCCGCGAGCTGG + Exonic
1107135813 13:36942735-36942757 ACTGCTGGGGCCAGGCGCGGTGG - Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113917524 13:113883443-113883465 GGTGCTGAGGGGACGCCCGCAGG - Intergenic
1116448088 14:45035246-45035268 GCTACTGGGGCGACTGGGGCAGG + Intronic
1117097701 14:52314680-52314702 GCTGCTGGCGCGCCGCTGGCGGG + Exonic
1117176783 14:53153376-53153398 GCTGCACCGGCGCCGCGCGCGGG + Intergenic
1118404620 14:65411875-65411897 TGTGCTGGGGCGGCGCGCTCCGG + Exonic
1122315527 14:100824174-100824196 GCTGCAGGGCTGACGCGGGCTGG + Intergenic
1123055079 14:105565820-105565842 GCTGCTGGGGTGATGGGCCCCGG + Intergenic
1123079527 14:105685664-105685686 GCTGCTGGGGTGATGGGCCCCGG + Intergenic
1124469296 15:29968884-29968906 GCTGCGGGTGCGGCGGGCGCGGG - Intergenic
1125180668 15:36878602-36878624 GCTGCTGTGGAGGCGGGCGCGGG + Intergenic
1126034917 15:44537022-44537044 GCGGCGGCGGCGACGCGCGCGGG - Intergenic
1128322665 15:66703909-66703931 GCAGCTGCGGCGGCGCGGGCTGG - Exonic
1129082495 15:73052741-73052763 GCTGCTCGGGCGCCGGGCGCCGG + Exonic
1132111656 15:99106043-99106065 GGTGCTGGGGCGACGGCAGCGGG - Intronic
1134070204 16:11255913-11255935 GCTGCGGGAGCCCCGCGCGCGGG + Intronic
1134172025 16:11976577-11976599 GGTGCTGAGGCTACGCGGGCTGG - Intronic
1136536375 16:30902269-30902291 GCAGCAGGCGCGGCGCGCGCGGG - Exonic
1137009554 16:35309370-35309392 GCTGCTGGTGCCACGCGGGCAGG - Intergenic
1140457830 16:75115038-75115060 GCTGCTGGGGGGACACCCGCGGG - Intronic
1141946934 16:87317142-87317164 GCTGCCGGGGGGCCGGGCGCGGG - Exonic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142118859 16:88376161-88376183 GTTGCTGGGGCGACTGGCGAAGG - Intergenic
1142151994 16:88516752-88516774 GCAGCTGGGGCGATCCGGGCAGG - Intronic
1142219859 16:88848789-88848811 GCTGCTGGAGGGATGGGCGCTGG + Intronic
1143116498 17:4584477-4584499 GCTGCCGGGGAGGCGGGCGCGGG - Intronic
1143586136 17:7851456-7851478 GCTGCTGGGGCGAAGAGCACAGG - Exonic
1147482425 17:40779609-40779631 GCTGCTGCAGCGAGGCGCTCTGG + Exonic
1148440360 17:47708858-47708880 GCTGCTGCGGCGAGGGGCACGGG - Exonic
1148957164 17:51363375-51363397 GCTGCTGGGGCCACGCGGGGGGG + Intergenic
1150639296 17:66938873-66938895 GCTGCTGGGGCAAAGCGGGGAGG + Intergenic
1152357328 17:79813503-79813525 GCGGCGGGGGCGGCGGGCGCGGG + Intergenic
1152372873 17:79901403-79901425 GCTGCTGGGGCGAGGGGCAGGGG - Intergenic
1160631254 18:80247556-80247578 GGAGGTGGGGCGGCGCGCGCCGG - Intergenic
1161741419 19:6023172-6023194 GCTGCTGGGGCGACCTGCCTGGG + Intronic
1162378969 19:10321013-10321035 GCTGGTGTGGTGCCGCGCGCAGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162954332 19:14090069-14090091 GCTGCTGTGGCGGCGCCGGCGGG + Exonic
1163720420 19:18895868-18895890 GCTGCTGGCGCTCGGCGCGCTGG - Exonic
1166369015 19:42291252-42291274 GCTGCTGGGGCAGCGTGGGCAGG - Exonic
1166389558 19:42401576-42401598 GCTGCTGCGGCGACCGCCGCAGG - Exonic
1168309161 19:55452071-55452093 GTTGCCATGGCGACGCGCGCGGG + Intergenic
1168408061 19:56120994-56121016 GCGGCCGGGGTGACGCGGGCGGG - Intronic
1168435718 19:56315377-56315399 GCTGCTCGCGCGAGGCGCTCTGG + Intronic
926140949 2:10367788-10367810 GCTGCTGCGGCCACCCTCGCCGG + Intronic
929452785 2:42048068-42048090 GCCGCCGGGGCCATGCGCGCGGG + Exonic
929555824 2:42925052-42925074 GCTGCAGGGGTGAGGCCCGCAGG + Intergenic
931566819 2:63622955-63622977 GCTGCTTGGGCGCCGTGCGGTGG - Intronic
932721785 2:74143983-74144005 TCTGCTGGGGCCAGGCGCGGTGG - Intronic
937160938 2:119760190-119760212 GCTGCTGGGCAGCCGCGGGCCGG - Exonic
938397759 2:130963621-130963643 GCGGCTGCGGCGGCGGGCGCGGG - Intronic
942453509 2:176122885-176122907 GCCGCCGGGGCCAGGCGCGCAGG + Exonic
945102511 2:206274972-206274994 GCGGCCGGGGCGACGCCCGCGGG + Intronic
946326131 2:218985463-218985485 GCAGCCGGGGAGACGCGCGGGGG + Exonic
948939795 2:241190063-241190085 GATGCTGCGGCGACGGGCCCAGG + Exonic
1170226350 20:13995531-13995553 GCTGCTGTGGCGGCGTCCGCGGG + Exonic
1172109436 20:32536591-32536613 CCTGCTGGAGCGGCTCGCGCGGG + Intronic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175429523 20:58891673-58891695 GCTGCGGCGGCGGCGGGCGCGGG - Intronic
1175847108 20:62065008-62065030 GCGGCGGGGGCGGCGGGCGCGGG + Exonic
1176201418 20:63862482-63862504 GCTGCTGCTCCGACGCACGCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1184523800 22:45009858-45009880 GCGGCTGGGCGGGCGCGCGCGGG - Intronic
1185171230 22:49295808-49295830 GCTGATGGGGCGGCGCAAGCCGG + Intergenic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950008006 3:9703931-9703953 GCTGCTGGGGCTAGGGGCGACGG - Exonic
952416830 3:33097166-33097188 GCTGCTGGGCCGACGAGGGGCGG - Exonic
953250064 3:41237363-41237385 GCTACTGGGGAGACGGGGGCAGG + Intronic
954702018 3:52455536-52455558 GCGGCGGGGGCGACGGGCGGCGG + Exonic
960960452 3:123067156-123067178 GCTGCTGGGATGGCGCGGGCCGG + Exonic
961373111 3:126444113-126444135 GCTGCTGGGGCTTCGTGGGCAGG - Intronic
961735941 3:129002185-129002207 GCTGTCGGGGCCAGGCGCGCAGG - Exonic
962250559 3:133833553-133833575 GCTGCTGGGGCAGGGCGGGCAGG - Intronic
966497999 3:180602387-180602409 GGTGCTGGGGCGGCGGGCCCCGG - Exonic
969681926 4:8647928-8647950 GCTGCTGGCACGAGGCGCTCAGG + Intergenic
969681934 4:8647967-8647989 GCTGCTGGCACGAGGCGCTCAGG + Intergenic
969715932 4:8868156-8868178 GCGGCTGGGGAGACACGCGGCGG - Exonic
969716648 4:8871267-8871289 GCTGCGGAGGCGCAGCGCGCTGG - Exonic
969716673 4:8871338-8871360 GCTGCTCGGGCCGGGCGCGCTGG - Exonic
975683389 4:76897495-76897517 GCTGCTGGGGCGGCTCCCCCCGG + Exonic
976600651 4:86935062-86935084 GCTGCGGCCGCAACGCGCGCAGG - Exonic
978361105 4:107931793-107931815 GCTGCGGAGGCGCCGGGCGCGGG + Exonic
979259910 4:118636207-118636229 GCTGCTGGGGCAACATGGGCAGG - Intergenic
986597507 5:9439064-9439086 GCTGCTGGGGCGTCTCAGGCAGG - Intronic
988564831 5:32312698-32312720 GCGGCCGGGGCGAGGGGCGCCGG - Intronic
990308752 5:54518348-54518370 GCTGCTGAGGCGACGGCTGCAGG - Exonic
992690701 5:79237361-79237383 GCTGCTGGTGCACGGCGCGCAGG - Exonic
992828123 5:80569648-80569670 GCAGCGGGAGCGGCGCGCGCTGG - Intronic
995512330 5:112921836-112921858 GCAGCTGCGGCGCCGGGCGCTGG - Intronic
1004441887 6:15662420-15662442 TCTGCTGGGCCGAGGGGCGCAGG + Intronic
1004978746 6:20998322-20998344 GCTGCTGAGGCCAGGCGCGGTGG + Intronic
1007414973 6:41686225-41686247 GCTGCTGCAGGGACGTGCGCTGG - Exonic
1008817085 6:55580543-55580565 GCTGCTGGGACTACAGGCGCCGG + Intergenic
1010980594 6:82365009-82365031 GCGGCTGGCGCGACTAGCGCTGG + Exonic
1013619283 6:111872875-111872897 GCGGCGGGGGCGGCGTGCGCGGG + Intronic
1013792979 6:113857288-113857310 GCGGATTGGCCGACGCGCGCGGG + Intergenic
1018400217 6:163414305-163414327 GCTGCGGGGCCGACGGCCGCGGG - Intronic
1020235052 7:6348799-6348821 GCTGCCGGGGCGACGCGGCGCGG - Exonic
1022112418 7:27239743-27239765 CCCGCTGGGGCGACGGGCTCCGG - Intergenic
1022114666 7:27251610-27251632 GCTGCGGTGGCGACTCGGGCCGG + Intergenic
1022396007 7:29989082-29989104 CCCGCTAGGCCGACGCGCGCGGG - Intronic
1025959063 7:66205009-66205031 GCTGCAGGGGAGCCGCGGGCAGG - Intergenic
1026707113 7:72703710-72703732 GCTGGTGTGGTGGCGCGCGCCGG + Intronic
1032159880 7:129502297-129502319 GCTGCCGGAGCGGCGGGCGCGGG - Intergenic
1034940035 7:155224765-155224787 GCTGCTGGGGAGACGGTAGCAGG + Intergenic
1036432461 8:8702988-8703010 GCTGCTGCGGCGAGGCCCGGCGG - Exonic
1039608409 8:38901149-38901171 GGTGCCGGGGCGCCGCGGGCTGG - Intergenic
1040599542 8:48870318-48870340 GCTGCCCGGGCGGCGCGCGCTGG + Intergenic
1045277634 8:100721850-100721872 GCTGCTGCGGGGCCGCGGGCGGG + Exonic
1045564460 8:103299077-103299099 GCGGCTGGGATGAGGCGCGCCGG + Intronic
1049268396 8:141681583-141681605 GCTGCTGGGGCCACCCGCCCTGG - Intergenic
1049409033 8:142464264-142464286 GCTGCTGGGACGCCGCGCGCGGG + Exonic
1049435820 8:142585760-142585782 GCTGCTGTGGAGACGGGTGCAGG - Intergenic
1049794461 8:144490217-144490239 GCTGCTGGGGCCGGGCGCGATGG + Intronic
1056475223 9:86946522-86946544 ACGGCGGGGGCGACGCGCCCGGG - Exonic
1057546260 9:96021897-96021919 GCTGCGGGGCCGACCCGCCCAGG + Intergenic
1057619133 9:96619492-96619514 GCTGCGGGGACGGCGGGCGCCGG + Exonic
1058885882 9:109320823-109320845 GCTGCTCCCGCGCCGCGCGCCGG + Exonic
1059119780 9:111631497-111631519 GCTGCTGGTGCGGCCCGCGGGGG + Exonic
1060468723 9:123930129-123930151 GCGGAGGGGGCGGCGCGCGCCGG - Intronic
1060554953 9:124503465-124503487 GCGGCTGGGGCGGCGGCCGCGGG - Intronic
1060826169 9:126689263-126689285 GCTGGTGGGGCGAAGTGGGCAGG - Intronic
1060881889 9:127123126-127123148 GCTGATGGGGAGAGGCGCTCTGG - Intronic
1062141790 9:134963218-134963240 GCTCCTGGGGCCTCGCGTGCTGG - Intergenic
1186435412 X:9538869-9538891 CCTGCTGGGGAGAAGCCCGCTGG + Intronic
1190094481 X:47467576-47467598 GCTGCTGGGGCGAGGCAAGCAGG + Exonic
1193111360 X:77733914-77733936 GGTGCTGGGGCCAGGCACGCTGG + Intronic
1199457152 X:148042195-148042217 GCAGCTGGGACTACGGGCGCCGG + Intergenic
1200714245 Y:6520057-6520079 GCTGCTGGGGCGAGGGCAGCGGG - Intergenic
1201019577 Y:9641100-9641122 GCTGCTGGGGCGAGGGCAGCGGG + Intergenic