ID: 1088680115

View in Genome Browser
Species Human (GRCh38)
Location 11:112233145-112233167
Sequence GCCTCCTAGAGACAAAACCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088680115_1088680116 9 Left 1088680115 11:112233145-112233167 CCTTGGTTTTGTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 14
4: 136
Right 1088680116 11:112233177-112233199 GCCCCTTGATCATAAGAATCTGG 0: 1
1: 0
2: 2
3: 3
4: 37
1088680115_1088680120 15 Left 1088680115 11:112233145-112233167 CCTTGGTTTTGTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 14
4: 136
Right 1088680120 11:112233183-112233205 TGATCATAAGAATCTGGATATGG 0: 1
1: 0
2: 1
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088680115 Original CRISPR GCCTCCTAGAGACAAAACCA AGG (reversed) Exonic
902099375 1:13973315-13973337 GCCTCCTAGGGAATAAAGCAGGG - Intergenic
904929303 1:34073728-34073750 GTCTCCTAGAGCCAGAAACAAGG - Intronic
906639383 1:47432628-47432650 GCCTCATAGAAGCAAAGCCAGGG - Intergenic
910486263 1:87717816-87717838 TCCTCCAAGAAACCAAACCAAGG + Intergenic
912964740 1:114227811-114227833 GCCTCCTAGAGAAAATACTTGGG + Intergenic
915997163 1:160575163-160575185 GCCTCCTAGAGTCAAAAAGTGGG + Intronic
917696224 1:177526893-177526915 GCCTCCCAGAGAGAAATACAAGG + Intergenic
920557023 1:206911620-206911642 GTGGCCTAGAGACAAAGCCAAGG + Intronic
920580998 1:207107589-207107611 GCCTCCTTGAGACTGAAGCATGG + Intronic
920718607 1:208365812-208365834 GTCTCCTAGAGAATCAACCATGG + Intergenic
924127539 1:240870900-240870922 TTCTCCTAGTGACAAAACGATGG - Intronic
1062958242 10:1554158-1554180 GCCACCCGGAGACAGAACCAGGG - Intronic
1063517560 10:6712061-6712083 GCCGCCTGAATACAAAACCAAGG - Intergenic
1067985865 10:51143875-51143897 GCCTCCTATACACATGACCAGGG - Intronic
1068943865 10:62708538-62708560 GTCTCCCAGAGACAAAACCCAGG - Intergenic
1073348392 10:102801704-102801726 CCCTCCTAAAGCCCAAACCAGGG - Intronic
1073893267 10:108124240-108124262 GCATCCTAGAGTCAACACAATGG + Intergenic
1077772987 11:5241506-5241528 GCTTCCTAGAGACCAATCAAGGG - Intergenic
1077931067 11:6733493-6733515 GTCTCATAGAGAAGAAACCATGG - Intergenic
1078296503 11:10076542-10076564 CCCTCCCTGAGACAAAAACATGG - Intronic
1080450837 11:32377602-32377624 GCCTCTGAGAGAAGAAACCAAGG + Intergenic
1081214365 11:40376669-40376691 AGCACCCAGAGACAAAACCAGGG + Intronic
1082776334 11:57247493-57247515 GGCTTCTAGAGTCAAAGCCAAGG - Intergenic
1083932518 11:65853685-65853707 GCCTCCTTGCTACAAAACCAGGG - Exonic
1085168164 11:74423504-74423526 GTCTCATAGAGTCAAAATCAAGG - Intergenic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1096717968 12:53502232-53502254 GACTCCAAGAAACAAAGCCATGG - Intronic
1096877805 12:54644257-54644279 GGGTCCTAGAGCCAAATCCAGGG + Intergenic
1099996315 12:89783411-89783433 ACTTCCTAGTGGCAAAACCAAGG + Intergenic
1104605053 12:130182008-130182030 GCACCCTAGAAAGAAAACCATGG + Intergenic
1106506953 13:30378825-30378847 TCCTTCTAGCTACAAAACCATGG + Intergenic
1108357584 13:49641627-49641649 GCCTCCTAGAGTGTAAAACAGGG + Intergenic
1109412617 13:61993159-61993181 GCCTCCCAGAGAGCAAACAATGG + Intergenic
1113126940 13:106989783-106989805 GTTACCTAGAAACAAAACCATGG - Intergenic
1115534828 14:34363235-34363257 ACCTCCTACAGACATAACTAAGG - Intronic
1117627149 14:57651618-57651640 CCCTCCTAGAGACAGGAACAGGG + Intronic
1117772553 14:59149687-59149709 GCCTGCTAGAGGCAATACAAGGG + Intergenic
1119193675 14:72701775-72701797 GCATCCCAGAGACAAAGCCTGGG + Intronic
1122261922 14:100528568-100528590 GCCTCATAGAAAGAAAGCCAAGG - Intronic
1123716421 15:23036136-23036158 GCCCCCTAGAGGTCAAACCAAGG - Intronic
1124181975 15:27484744-27484766 GCCACCTACACACAAAATCATGG + Intronic
1124955632 15:34358411-34358433 GCCCCCTAGAGACACAATTATGG - Intergenic
1126255055 15:46615712-46615734 GTCTCCTAGATACCATACCAGGG + Intergenic
1127695682 15:61444376-61444398 TCCTACTAGAGACAGAACCCTGG - Intergenic
1128527216 15:68420871-68420893 GCCTCGGAGAGACTAAAGCAGGG + Intronic
1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG + Intergenic
1134325710 16:13205674-13205696 GGCTACTAGAAACAAGACCAGGG - Intronic
1135990878 16:27218006-27218028 GCCTCCTTTACACAAAGCCAGGG - Intronic
1136285382 16:29237490-29237512 GCCTCCCCTAGACATAACCAAGG + Intergenic
1142090707 16:88207622-88207644 GCCTCCCCTAGACATAACCAAGG + Intergenic
1142137633 16:88458931-88458953 GCCTCCTAATGACACAAGCAAGG - Intronic
1144726563 17:17505348-17505370 GTCTCCTGGAGATGAAACCATGG + Intergenic
1149584329 17:57775241-57775263 TCAACCTATAGACAAAACCAAGG + Intergenic
1155118126 18:22790809-22790831 GCCTGCTACAGATAAAACCTGGG + Intergenic
1158215691 18:55098263-55098285 GCCTCCTAGAGTGAATACAAAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160939599 19:1614166-1614188 GCCCCCTAGAGACTAAGACAGGG - Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164731532 19:30508606-30508628 GCCTCTTAGAAATTAAACCAGGG - Intronic
1166253883 19:41588948-41588970 GCCTCCCAGAGACCACACCCTGG - Intronic
1166409668 19:42548095-42548117 GCCTCCCAGAGACCACACCCTGG + Intronic
1167516107 19:49924126-49924148 ACCTCCCAGAGACTACACCATGG + Intronic
1167784534 19:51626332-51626354 CCCTCTTACACACAAAACCATGG + Intronic
1168517739 19:57022548-57022570 CCCTCCAAGAGACAAACCCAGGG - Intergenic
926562523 2:14433856-14433878 GCCCCAAAGATACAAAACCAAGG - Intergenic
927137097 2:20105180-20105202 GTCACCTAGAGCCAAAGCCACGG + Intergenic
928622804 2:33108207-33108229 GCCCCCCAGAGACAGAAGCAAGG - Intronic
929464906 2:42135596-42135618 GCCTCCTATGGTCCAAACCAAGG + Intergenic
931291726 2:60880120-60880142 CCCTCCTAGAGACAGAAACATGG - Intergenic
935759845 2:106310715-106310737 GCCTCCCAGAGGCATCACCAGGG - Intergenic
937195096 2:120147340-120147362 GCCCCTTAGAAAAAAAACCAGGG - Intronic
939991400 2:148879261-148879283 GCCTTCTACAGACAAAGCCCTGG - Intronic
947476984 2:230459074-230459096 GTCTCTTAGAGACAGAACCAGGG - Intronic
947985832 2:234446766-234446788 GCGTCTCAGAGACAAGACCAAGG - Intergenic
949057675 2:241937329-241937351 GCCTCCCCGAGACACAGCCAAGG + Intergenic
1170977155 20:21175708-21175730 GCCTCCTAGAGACTTAACTAAGG - Intronic
1174058737 20:47817410-47817432 GCCTCCTTGTGACCAAAACATGG + Intergenic
1174159561 20:48541267-48541289 GCCTCCTTGTGACAAAAACATGG - Intergenic
1174379301 20:50146481-50146503 GGCACCCAGAGACAAAGCCATGG - Intronic
1177545658 21:22554910-22554932 GCCTCTTAGAGTCTAAAGCAGGG + Intergenic
1178154598 21:29836882-29836904 GGCTCCTAGAGACAAAATGTAGG - Intronic
1179437706 21:41373696-41373718 GGCTCCAAAAGACAAACCCAGGG - Intronic
1182163791 22:28151339-28151361 GCCTGCTGGAGACACAACTATGG + Intronic
950476209 3:13216453-13216475 GCCCCCCAGAGACACACCCAGGG + Intergenic
950698500 3:14723010-14723032 GGCTCCTAGAAGCAAAAGCAGGG + Intronic
954940823 3:54371216-54371238 GACTCCTAGATACACACCCAAGG - Intronic
955524314 3:59805044-59805066 TCCCTCTAGAGACAAACCCAAGG - Intronic
958044730 3:88269847-88269869 TCCACCTAGAGACCAAACCACGG - Intergenic
961321486 3:126079475-126079497 AACTCCTACAGAGAAAACCATGG + Intronic
962481853 3:135804860-135804882 GACTCCTGTAGAGAAAACCATGG - Intergenic
966667834 3:182492168-182492190 GACTCCTAGAGAGAAAATCCAGG + Intergenic
968707998 4:2092296-2092318 GGCTCCTAGAGTCAAATCCTTGG - Intronic
970171110 4:13291278-13291300 CCCACCAAGAGACAAGACCATGG - Intergenic
970461842 4:16282529-16282551 AACTCCCAGAGACAAAACAACGG + Intergenic
971040605 4:22747826-22747848 GCCTCCATGAGTCAAAAGCAAGG + Intergenic
971143331 4:23948529-23948551 GCCTCCTAGAGAGAAACCAAAGG - Intergenic
971759385 4:30745688-30745710 TCCACCAAGACACAAAACCAGGG - Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
976074226 4:81278552-81278574 GCCTCCTGGAGACAATTCCTAGG - Intergenic
981137264 4:141224851-141224873 ACATCAAAGAGACAAAACCAAGG - Intronic
981268670 4:142818373-142818395 GCCTCTGAGAGAAAAACCCATGG - Intronic
988682477 5:33497483-33497505 CCCTCATAGTGACAAAACAAAGG + Intergenic
989686953 5:44100382-44100404 GTCCCAGAGAGACAAAACCAAGG + Intergenic
990621784 5:57567802-57567824 GCCTCCTAGAGAAGAAAGCAGGG - Intergenic
991243572 5:64485574-64485596 GCCTCCTAAATATAAAACCCTGG + Intergenic
992156602 5:73961150-73961172 GCCATCTAGCGACAAAACCTTGG - Intergenic
995022310 5:107380572-107380594 GCCTCCTAGAAAAAAAAAAAAGG + Exonic
997587456 5:135051902-135051924 GCCACATGGAAACAAAACCAGGG - Intronic
997814096 5:136999409-136999431 TCCTCCCTCAGACAAAACCAGGG + Intronic
997856236 5:137375261-137375283 GACTTCTAGACACAACACCATGG + Intronic
998557832 5:143143026-143143048 GCCTCATAGAGCCAAAAGGAGGG - Intronic
1000992432 5:167924714-167924736 TCCACCTAGAGGCAAAACCTGGG + Intronic
1003341330 6:5224048-5224070 GCCTCCAGGAGAGAAAACCAGGG - Intronic
1005360685 6:25028226-25028248 GTCTCCTAGAGGCAGAACAAGGG - Intronic
1006838066 6:37011152-37011174 GCTTCCTGGAGTCAAAGCCAGGG - Intronic
1007523625 6:42471825-42471847 GCCTAGTGGAGACAGAACCAAGG - Intergenic
1007539523 6:42628119-42628141 GACTCCAGGAGATAAAACCAGGG - Intronic
1009400890 6:63254325-63254347 GTCTCCTTGAGCCAAAATCAAGG + Intergenic
1010021047 6:71160257-71160279 TAATCCAAGAGACAAAACCAGGG - Intergenic
1013987201 6:116209221-116209243 GGCACCAAGAGACAAAATCAAGG + Intronic
1014469004 6:121791944-121791966 GCCACCTAGAGGCAAAGCCTGGG + Intergenic
1015854694 6:137611061-137611083 GCCTCCTATAAACACAACCCTGG + Intergenic
1016337137 6:143018955-143018977 GCCACCTGGAGAAAAACCCAAGG - Intergenic
1016960060 6:149664855-149664877 GACTACTAGAGACAAAAAAATGG - Intronic
1020284262 7:6667978-6668000 GGCTTCTACAGACAAAACCTGGG - Intergenic
1023132141 7:37013895-37013917 GCCTCCTGGAGAAATAATCATGG - Intronic
1026740330 7:72975146-72975168 GACTCCTTGAGACAATCCCAGGG + Intergenic
1027103401 7:75389924-75389946 GACTCCTTGAGACAATCCCAGGG - Intergenic
1029478192 7:100797568-100797590 GCCTTCTAGAGAGAAAACGCAGG + Exonic
1034976230 7:155450508-155450530 GCCTCCTAGGGACACAGCCCTGG + Intergenic
1035671755 8:1423362-1423384 CCCTCCCAGAGACAGAACCTGGG - Intergenic
1042770773 8:72379456-72379478 GCATCCTAGAAGAAAAACCAAGG + Intergenic
1047761845 8:127960348-127960370 GCCTCCAGGAGGCAAGACCAGGG - Intergenic
1048084939 8:131167252-131167274 GTTTCCCAGAGAGAAAACCAAGG - Intergenic
1049154984 8:141060880-141060902 GCCACGTAGAGAGAAAACCGAGG + Intergenic
1049654967 8:143793329-143793351 GCCTTTTTTAGACAAAACCAGGG - Intronic
1050828708 9:9983931-9983953 CCCTCTTAGAGACATAACTAAGG + Intronic
1054988297 9:71288902-71288924 TCCACCTAGAGTCAAAACCAAGG - Intronic
1056037322 9:82620418-82620440 ACCCCCTTGAGACAAAACCCTGG + Intergenic
1060470751 9:123946161-123946183 GCCTCCTGGAGAAAACAACAAGG - Intergenic
1185825566 X:3245855-3245877 GAGTCCTGGAGACAAAACCAGGG - Intergenic
1187731059 X:22255250-22255272 GCATCATAGGGTCAAAACCAAGG - Intergenic
1188403386 X:29775873-29775895 TCCTCCTAGTTACAAAGCCAAGG + Intronic
1191885434 X:65883257-65883279 GCCTCCTAAAGAAAAATCCAAGG + Intergenic
1192684957 X:73294115-73294137 GGCAGCTACAGACAAAACCAAGG + Intergenic
1193156787 X:78182991-78183013 GCCTCCTGGACACAACTCCAGGG + Intergenic
1193325236 X:80172563-80172585 GCATCCCAGAGTCAAAACAATGG - Intergenic
1194607474 X:95998768-95998790 GGCTCCAAAAGATAAAACCAGGG + Intergenic
1195567114 X:106353500-106353522 CCCTCCTTGATACATAACCAAGG + Intergenic
1197649702 X:129051387-129051409 GCATCCTAGAGACAAAGCACGGG - Intergenic
1199097480 X:143759396-143759418 GCCTCCTGGATACAAAACCATGG - Intergenic
1201390328 Y:13490409-13490431 GGCTCCTGGAGACCACACCATGG - Intergenic