ID: 1088680452

View in Genome Browser
Species Human (GRCh38)
Location 11:112237096-112237118
Sequence CAGTGGAAATAGATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088680448_1088680452 -5 Left 1088680448 11:112237078-112237100 CCTGGACCATGGGGGTGGCAGTG 0: 1
1: 0
2: 3
3: 42
4: 667
Right 1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG 0: 1
1: 0
2: 5
3: 37
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088680452 Original CRISPR CAGTGGAAATAGATGGAAGA AGG Intronic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
902875938 1:19340856-19340878 CAGTGGAAAGAGTGGGTAGAGGG + Intronic
903003260 1:20281573-20281595 CTGTGGTAATAGATAAAAGATGG - Intergenic
903096734 1:20983372-20983394 CAGTGGAGATAACTAGAAGATGG - Intronic
904291314 1:29487831-29487853 TAGAGGAAACTGATGGAAGAAGG + Intergenic
904644878 1:31958185-31958207 CAGTGGAGACAGAGGGGAGAGGG - Intergenic
905495750 1:38384515-38384537 CAGAGGAGAAAGATGGAAGGTGG - Intergenic
905521228 1:38602083-38602105 CAGTGGAATTACATGGCAGCAGG + Intergenic
905791445 1:40791778-40791800 CACTGGAAATAAATGGAGCATGG + Intronic
906093313 1:43201360-43201382 CAGTGGTACTAGATGTCAGAGGG + Intronic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
907928762 1:58979449-58979471 CAGTGGAATTAAGTGCAAGAGGG + Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909255268 1:73412679-73412701 CACTTGAAATAGAAGAAAGATGG - Intergenic
909653494 1:78002478-78002500 CATTGCAAATAGATGAAATAGGG - Intronic
910964389 1:92793824-92793846 TAATGGAAAAAGATGGAAGGGGG - Intergenic
911121999 1:94305643-94305665 CAGTGCCAATAGATGGCAGGGGG + Intergenic
911382482 1:97132623-97132645 CACATGAAAAAGATGGAAGAAGG - Intronic
911471571 1:98325652-98325674 CATTTGAAAAAGAAGGAAGAAGG - Intergenic
912400982 1:109392492-109392514 TTGTGGAAATAATTGGAAGAAGG - Intronic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
917500364 1:175579742-175579764 CCTTGGAAATAGAGGGGAGAGGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
919090606 1:192974659-192974681 GAGTTGAGAAAGATGGAAGAAGG + Intergenic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919917508 1:202147890-202147912 CAGTTGAAATCTCTGGAAGAGGG - Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920356305 1:205375809-205375831 CAGTGCAAATAGATAGGACAGGG - Intergenic
921415128 1:214877214-214877236 CAGGGGAGAAAGATGGGAGAAGG + Intergenic
922197973 1:223376183-223376205 CAGTGTAAACAGATTTAAGATGG - Intergenic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
1062789662 10:294201-294223 CCTTGGAAGAAGATGGAAGAGGG - Intronic
1063117130 10:3079561-3079583 AAGTGGAAAGACATAGAAGAAGG - Intronic
1063169629 10:3495985-3496007 CAGTAAAAATACATAGAAGAAGG - Intergenic
1063775324 10:9256814-9256836 CAGAGGAAATTGATGGAGTACGG + Intergenic
1064336212 10:14445069-14445091 AAATGGAAATAAAAGGAAGAAGG + Intronic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069506001 10:68998635-68998657 TAGTGGCAAAAGATGGTAGAAGG + Intronic
1070508019 10:77132966-77132988 CTCTGGAAATAAATGGAAGATGG + Intronic
1070906107 10:80074739-80074761 AAGTTGAAATACCTGGAAGAAGG - Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1072028779 10:91496054-91496076 AAGGGGAAATAAATGAAAGAGGG + Intronic
1074656100 10:115588848-115588870 CAGTGGTAATATCTGCAAGATGG - Intronic
1075842518 10:125517241-125517263 CTGTGGAAAGTGTTGGAAGATGG + Intergenic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085783675 11:79433019-79433041 CAGTGGAAATAAAGTGCAGAGGG - Intronic
1086066879 11:82754958-82754980 CAGTGGAAAGAGTGTGAAGATGG - Intergenic
1086588923 11:88488567-88488589 AAGTTGAAGGAGATGGAAGAAGG - Intergenic
1087343120 11:96934471-96934493 CAAAGGAACTAGATGGAAGCAGG + Intergenic
1087884476 11:103462141-103462163 CAGTGGTAATAAATGAAAGGTGG - Intronic
1088070226 11:105774440-105774462 AAGTGGAAATTGAAGGAATAGGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089127473 11:116186844-116186866 CATAGGAGATAGATGGGAGATGG + Intergenic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092029766 12:5274536-5274558 CACTGGAAATAGGTGAAAGCAGG - Intergenic
1094037869 12:26090048-26090070 AAGAGGTAACAGATGGAAGAAGG + Intergenic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1095796089 12:46220232-46220254 CATTTGAAATACATGGAAAAGGG - Intronic
1097155894 12:57012166-57012188 CAGAGGAAAGAGATGAAAGACGG + Exonic
1100469641 12:94878905-94878927 CTGTGTAAATAGATTGCAGATGG - Intergenic
1100962578 12:99979589-99979611 CAGAAGAATTAGATGCAAGAGGG + Intronic
1101321640 12:103678099-103678121 CTGTGGAAAGAGGTGGAAGCAGG - Intronic
1101676433 12:106921220-106921242 CACTGGAAAGAGAATGAAGAGGG - Intergenic
1102396247 12:112588805-112588827 CAGTGGACATAGGAGGCAGATGG + Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106962150 13:35011089-35011111 CAGAGGACATAGGTGGAAGGTGG + Intronic
1106986940 13:35364313-35364335 CACTGAAAATAGTTTGAAGATGG + Intronic
1107167869 13:37303952-37303974 CAGTGGAAAATGAAGAAAGAAGG - Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1108603897 13:52017899-52017921 CAGTGAAAATAGAATAAAGATGG - Intronic
1110010891 13:70332028-70332050 CAGGGGAGAAAGATGGAAGCCGG - Intergenic
1110348583 13:74478788-74478810 TAGAAGAAAAAGATGGAAGAAGG - Intergenic
1110897558 13:80773958-80773980 TACTGAAAATAGATGGAAAAAGG - Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112093246 13:96105256-96105278 CTGTGGAAAGACATGGAAGTAGG + Intronic
1112953032 13:105025895-105025917 CAGTGGAAATAGACTTCAGAAGG - Intergenic
1113119077 13:106906984-106907006 CAGACAAAATAGATGCAAGAGGG - Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1114815204 14:25949290-25949312 CAGTGGTAATAGAGAGATGAAGG - Intergenic
1115733135 14:36293687-36293709 CATTGGAACTAGATGGTAAATGG + Intergenic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116779242 14:49217863-49217885 CAATGGAACAAGATGGAAAAAGG + Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1117226487 14:53666119-53666141 CTGTGGAAATAGGTAGAAGAAGG - Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118434341 14:65755815-65755837 CATAGGAATAAGATGGAAGAGGG - Intergenic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119469250 14:74883466-74883488 GAGTGGCAAGAGATAGAAGATGG + Intronic
1120637714 14:86972659-86972681 AAGTGCAAATAGATTTAAGATGG - Intergenic
1121049023 14:90807991-90808013 CAGTGAAACTAGTTGGAAGTGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121575477 14:94981429-94981451 GAGTGCAAATAGTTGGGAGATGG + Intergenic
1121726179 14:96152125-96152147 CAAAGGAAATAGAAGAAAGAAGG + Intergenic
1122441788 14:101737033-101737055 CAGAGAAAATAGAAGGCAGAAGG - Intergenic
1122462548 14:101907542-101907564 CAATGGAAAGAGATGAAAGAAGG - Intronic
1124200950 15:27678100-27678122 CAGTGGAAGTTAGTGGAAGAAGG - Intergenic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126891288 15:53207132-53207154 CAGTAGAAATATGTGGATGATGG + Intergenic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127229393 15:56971898-56971920 TAGCGGGAGTAGATGGAAGAAGG + Intronic
1128399400 15:67262324-67262346 AGGTGGAGATTGATGGAAGATGG - Intronic
1128594730 15:68933494-68933516 CAGTGCAAATACATTAAAGAGGG - Intronic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1133838674 16:9388900-9388922 CAGTGGATATTGGTGGAAAAAGG + Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134299356 16:12975750-12975772 GACTGGAAAAAGAGGGAAGATGG + Intronic
1135165128 16:20132346-20132368 CAGTAGAAATATCTGGAACAAGG + Intergenic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1141045192 16:80709707-80709729 CTGTGGAAGTAGATGTGAGAAGG - Intronic
1141059880 16:80856631-80856653 GAGTTGTAATAGATGGATGAAGG - Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1143156138 17:4837635-4837657 CAGTGGAAGTGGATGGGACAAGG + Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1145992133 17:29085647-29085669 AACTGGAAATAGAAGGAAAATGG + Exonic
1147161294 17:38570847-38570869 CAAAGGATAAAGATGGAAGAGGG + Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1152476389 17:80521168-80521190 CAGTGGAAAAAGATCAGAGACGG - Intergenic
1153117065 18:1671333-1671355 ATGTGGAAATAGATGAATGAAGG + Intergenic
1153936374 18:9928428-9928450 CAGTGGAAGTAACTGGGAGAGGG - Intronic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1156542773 18:37931789-37931811 CAGTGGAACAATATGAAAGATGG + Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1157110481 18:44816068-44816090 CAGGGACAATAGATGAAAGAAGG + Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157675921 18:49568717-49568739 CAGTGGATTTAGCTGGGAGAAGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158474585 18:57768760-57768782 AAGTGGAAATTGATGCAAGGAGG + Intronic
1158716984 18:59889314-59889336 CAGCGAGAATAGATGGAAAAAGG + Intergenic
1158897721 18:61930875-61930897 CAGTAGAAATAGAAGCAAGATGG + Intergenic
1159024253 18:63168170-63168192 CATTGGCAATGGATGGAACAAGG - Intronic
1159041378 18:63325989-63326011 AAGTGGATATAGTTGCAAGAAGG - Intergenic
1159408545 18:68038350-68038372 CATTGGAAATATACAGAAGATGG + Intergenic
1159529597 18:69638727-69638749 CAATGGGAATAGCTTGAAGAAGG + Intronic
1159746507 18:72242839-72242861 AATTGGAATTAGATGTAAGAGGG + Intergenic
1160438332 18:78868211-78868233 CAGTGGACCTAGTTGGAAGTGGG - Intergenic
1160467562 18:79094304-79094326 CAGTGGAGAAAGCTGGACGAGGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1163044726 19:14631870-14631892 AAGTGGAAGTAGCAGGAAGAGGG + Intronic
1163208178 19:15819563-15819585 GAGAGGACAAAGATGGAAGAGGG + Intergenic
1163452337 19:17385860-17385882 CAGTGGAAATAAATGCATAATGG + Intergenic
1166176782 19:41078829-41078851 CACTGGCAAGAGATGGAAGGGGG + Intergenic
1167684578 19:50948797-50948819 AAGTGGAGAAAGATGGAAGGCGG + Intronic
925957567 2:8982610-8982632 CACTGGAAGTAGATGGATGGAGG - Intronic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926472558 2:13279434-13279456 TATTGGAAAGAGCTGGAAGAGGG - Intergenic
926587526 2:14704689-14704711 CATTAGAAATAGTTGGAATATGG + Intergenic
927061458 2:19426488-19426510 CATGGGAGATAGATGAAAGACGG - Intergenic
927677009 2:25113736-25113758 CAGTGGAAATTCATGGAGTATGG + Intronic
928209341 2:29312063-29312085 CACTGGCAATAGTTGGGAGAGGG + Intronic
928948070 2:36789934-36789956 CAGTGGTAACAGAGGGGAGAAGG - Intronic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
929655229 2:43724274-43724296 GAGTGAGCATAGATGGAAGAAGG + Intronic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930685186 2:54300207-54300229 GAGTGGTAATTGATGGAACAAGG - Intronic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932105588 2:68938270-68938292 CAGTGGAACTAGATGCTTGAAGG - Intergenic
932388330 2:71359435-71359457 TGGTACAAATAGATGGAAGAAGG - Intronic
933273619 2:80260290-80260312 CAGTGAAGAAAGATGGCAGAGGG + Intronic
934583727 2:95469484-95469506 TCGTGGAAATACAGGGAAGAAGG + Intergenic
934595725 2:95607230-95607252 TCGTGGAAATACAGGGAAGAAGG - Intergenic
934812334 2:97291081-97291103 CAGTGAAAATATAAGTAAGATGG + Intergenic
934825360 2:97416842-97416864 CAGTGAAAATATAAGTAAGATGG - Intergenic
936924070 2:117718926-117718948 GTGTGGAGATAGATGGAAGGGGG - Intergenic
937563428 2:123254233-123254255 AAATGGGAATAGATAGAAGAAGG + Intergenic
939280842 2:140062691-140062713 AAATTGAAATTGATGGAAGATGG - Intergenic
940769291 2:157823560-157823582 AAGTGGAAATACAGTGAAGATGG + Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941204704 2:162557499-162557521 CAGTGGCAAAAGATGGGAGATGG + Intronic
941467872 2:165851965-165851987 CAGTAAAAATAGATAGAAAAAGG - Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944259675 2:197662924-197662946 CTGAGGAAATAAATGGAAGGGGG - Intronic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
945180547 2:207087014-207087036 AGATGGAAATAGAAGGAAGATGG + Intronic
945424145 2:209678834-209678856 CAGTGGAAAAAGATGAAAATAGG - Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
948120569 2:235527108-235527130 CAGTAGAAATAGATAAAGGATGG + Intronic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172754912 20:37276760-37276782 CTCTGGAAATGGATGGTAGACGG + Intergenic
1172908088 20:38384458-38384480 CATTGGAAATACCTGGAAGATGG - Intergenic
1173920437 20:46740702-46740724 CGGTGGAACAAGATGGAAGGTGG + Intergenic
1174345633 20:49927489-49927511 CATGGGAAATAGTTGGAAAATGG + Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179373405 21:40827966-40827988 CAGAGGAATTGGATGGAAGAAGG + Intronic
1180116144 21:45706481-45706503 CAGTAGAGAGAGATGGCAGAGGG - Intronic
1181612760 22:24029707-24029729 GAGTGGAAATAGAAGGCAGTGGG + Intronic
1181944351 22:26504380-26504402 CAGTGGAACTAAATGGAAGGGGG - Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182758241 22:32698873-32698895 CAGTGGCATGAGATGGAGGAGGG + Intronic
1183698484 22:39436710-39436732 CAGTGGACACAGATGCATGAGGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949317234 3:2770326-2770348 AAATAGAAAGAGATGGAAGAGGG - Intronic
949682297 3:6528070-6528092 CTGTGGAAATAGATGTAATCTGG - Intergenic
949687983 3:6600036-6600058 CAATAGAAATACATGGAAAAAGG + Intergenic
950264502 3:11564151-11564173 CTGGGGAAATATATGGGAGAAGG - Intronic
951543484 3:23805607-23805629 GATTGGAACTAGATGGAATAGGG - Intergenic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952594309 3:34997420-34997442 GGGTGGAAATAGATGTAATATGG + Intergenic
953650131 3:44795085-44795107 CAGTGAACATAGATGGGATAGGG + Intronic
953719148 3:45340162-45340184 CATTGAAAATAGAAGGAAGTTGG - Intergenic
953935241 3:47036146-47036168 TATTGGGAATAGGTGGAAGAAGG - Intronic
954095380 3:48322268-48322290 GAGGGGAAATAGTTGGAAGAGGG - Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956581161 3:70815324-70815346 CATAGGAACAAGATGGAAGAAGG + Intergenic
956807329 3:72828353-72828375 CAGGGGAAATAAATGGCAAAGGG + Intronic
956959908 3:74387036-74387058 CAGTGGAAAGCGATGCAAGCAGG + Intronic
957423033 3:79996537-79996559 CAGAGCAAATATATTGAAGAGGG + Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
960040402 3:113144521-113144543 CAGTGGAAATAAATGGTAGTGGG + Intergenic
962853577 3:139325675-139325697 CAGTGGAAACAGGTGCAAGGAGG + Intronic
963217929 3:142771999-142772021 CAGTAGAAACAGATGCCAGAAGG - Intronic
963244917 3:143048888-143048910 AAGTGAAAATAGATGGAAAAAGG + Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
965190284 3:165519123-165519145 GTGTGGAAAATGATGGAAGATGG - Intergenic
965841189 3:172907411-172907433 AGTTGGAAATAGATTGAAGAAGG - Intronic
966423709 3:179758892-179758914 CAGTGGTTATAGATGGGTGATGG - Intronic
966555726 3:181258194-181258216 CAGTGGAACTTGGTGAAAGATGG + Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967084375 3:186080449-186080471 CCCTGGAAATAGTTGGGAGAGGG - Intronic
967115320 3:186332373-186332395 CAGTGGAAATTTAAGGAAGCAGG + Intronic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970486703 4:16531912-16531934 CAGTTCAAACAGATGGAGGAAGG + Intronic
970813429 4:20124428-20124450 CAGTGGATATAGTTAGAAAAGGG - Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971455265 4:26838118-26838140 CAGAGGAAATGGATGGGAAAGGG - Intergenic
971909348 4:32775313-32775335 AAGAGGAAATAAATGGAAAATGG + Intergenic
973816008 4:54619692-54619714 CAGAGGAGATATATGCAAGATGG + Intergenic
973842584 4:54877111-54877133 CATTTGAACTTGATGGAAGATGG - Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
974642147 4:64645060-64645082 GGGTGGAAATAAAGGGAAGATGG - Intergenic
974783718 4:66589636-66589658 CATTAGAAATAGATGGAGTAGGG + Intergenic
975057636 4:69954515-69954537 CACTGGAAATATAAGAAAGATGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976466674 4:85377325-85377347 TACTGAAAATAGATGGAAGGGGG - Intergenic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG + Intergenic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
981686681 4:147462406-147462428 CACTGGATATCCATGGAAGATGG + Intergenic
982081351 4:151793331-151793353 CAGAGGAAGTGGATCGAAGAAGG + Intergenic
982828206 4:160026996-160027018 GAGTGAAAATAGATGGTAGCTGG - Intergenic
984421308 4:179525676-179525698 CAGTGGAAATAATTGGATTATGG - Intergenic
986278649 5:6304497-6304519 GAAGGGAAAAAGATGGAAGAAGG + Intergenic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
987843637 5:23253920-23253942 AAATGGAAATAGATGGATGTTGG + Intergenic
987941945 5:24550295-24550317 AAGTGGAAAGACATGAAAGATGG - Intronic
990293439 5:54378368-54378390 CAGTTGATATAGAAGGGAGAGGG + Intergenic
990315541 5:54579526-54579548 CTCTGTAAATAGATGGATGAAGG - Intergenic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
994425582 5:99581237-99581259 CAGGGGAAATTGATAGAAGAAGG - Intergenic
994435759 5:99731004-99731026 CAGGGGAAATTGATAGAAGAAGG + Intergenic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
994900647 5:105764510-105764532 CAGTGGAATTATATGGGAGGTGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995679636 5:114702604-114702626 CTGTGGAAATAGATAACAGAAGG + Intergenic
995727416 5:115196041-115196063 CAGTGAAAATAGATGGCACACGG + Intergenic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
999185654 5:149706485-149706507 GAGTGGAAAGAAATGAAAGAAGG - Intergenic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000631848 5:163599675-163599697 CAATGGAAAGAGATGGAGTATGG + Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1001637844 5:173225282-173225304 CAGTGTAAATAAATAGATGATGG - Intergenic
1003203551 6:3986710-3986732 CAGTGGAGATAAAAGGTAGATGG - Intergenic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1005770960 6:29070721-29070743 CAGTGGAAATACATGAAGGATGG + Intronic
1006867812 6:37222992-37223014 CAGTGGACATAAATGGTAGCAGG + Intronic
1007343455 6:41208896-41208918 CAGGGGAAGTAGATCTAAGAGGG + Intergenic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1008300444 6:49831487-49831509 CAGAGGACGTAGATGGAGGAGGG + Intergenic
1008581707 6:52913980-52914002 CAGTGGAAGGAGATGGGACAAGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009950860 6:70394165-70394187 CAGTGGAAAAATAAAGAAGAAGG + Intergenic
1012505621 6:99943113-99943135 CAGTCGAAATGGTTGGACGAGGG + Exonic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1014189483 6:118476580-118476602 CAGTAGAAATAGTGGGAAAATGG - Intronic
1015674670 6:135731690-135731712 CACTGGAAATAAATAAAAGATGG - Intergenic
1015900672 6:138062133-138062155 AAAAGGAAATAGATGGAAAATGG + Intergenic
1017264363 6:152425130-152425152 CAGTTGAAATAGATTAAAGACGG - Intronic
1017782085 6:157723253-157723275 CAGTGAAAATAGAGGTTAGAAGG - Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018614431 6:165673180-165673202 CAGATAAACTAGATGGAAGAAGG + Intronic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1022134285 7:27432534-27432556 CTGAGGAAATAAATGGAAGGAGG - Intergenic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023703332 7:42913553-42913575 AAGTAGAAATAGATGAAAAATGG + Intronic
1024211652 7:47211209-47211231 CAGAGGCAATAGATGGCAAATGG + Intergenic
1026297888 7:69071397-69071419 CCATGGACACAGATGGAAGAGGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027755695 7:82209279-82209301 CAGTGGACATAGATGTATGACGG - Intronic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1028203666 7:87992226-87992248 CAGAGGAAAGAGATGGAACAAGG + Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1030154990 7:106445608-106445630 AACTGGAGATAGATGGTAGAAGG - Intergenic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1030580312 7:111346956-111346978 CTGTGATAATAGATGGCAGAGGG + Intronic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1038163612 8:25063735-25063757 CAGTGGAATTTGATAGAAGCAGG - Intergenic
1038389819 8:27185964-27185986 GAATGGAAATAGATTGTAGATGG - Intergenic
1038815250 8:30896333-30896355 GAGTGAAAATAGATGAAAAATGG - Intergenic
1039125724 8:34199449-34199471 AAGTAGAGAAAGATGGAAGATGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1041118232 8:54561047-54561069 CAGTGTAAATGGGTGGAAGTGGG + Intergenic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1043459172 8:80442070-80442092 GAGTGGAAATGGATGGAATTAGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043659644 8:82722078-82722100 CAGGGGAAATAGATGCACAATGG - Intergenic
1045393712 8:101739610-101739632 CAGGGGAGAAAGATGGAAGCCGG - Intronic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046549351 8:115694083-115694105 CAGTGGCATTAGATGTGAGATGG - Intronic
1047015514 8:120719301-120719323 CACTGGAGATAGATGTAAGCTGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048326365 8:133442373-133442395 CAGTGGCAAAAGATGGGAGCAGG - Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050223200 9:3420169-3420191 CAGTGCAAAAATCTGGAAGAAGG - Intronic
1050460704 9:5875256-5875278 CAGTGTACGTAGTTGGAAGAGGG + Intergenic
1050712601 9:8482746-8482768 AAGTGGCAAGAGAAGGAAGAAGG - Intronic
1050713473 9:8492745-8492767 CAGAGGAAATAAATGGACTATGG - Intronic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050763971 9:9109664-9109686 TAGTGGAAATATTTGCAAGAAGG + Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051439716 9:17071928-17071950 CAGTGGTAATATATGGACGCAGG + Intergenic
1052150761 9:25112710-25112732 CATTGGAAATAAATAGAAGTGGG - Intergenic
1052260856 9:26514816-26514838 CAGTGCAAATAGATCAAATAAGG + Intergenic
1052553797 9:29986672-29986694 CAGTGGACACTGATGGGAGAGGG + Intergenic
1054726458 9:68656662-68656684 CAGTACAAATAGATGAAACAGGG + Intergenic
1056118342 9:83462719-83462741 CAGCCGAAATTGCTGGAAGATGG - Intronic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056703907 9:88935243-88935265 CAGTGGAATTAGGAGGAAGGAGG - Intergenic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059370018 9:113822641-113822663 TAGAAGAAAAAGATGGAAGAAGG + Intergenic
1060351561 9:122865730-122865752 CAATGGGAATAGATTGAAAAAGG + Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060386314 9:123232368-123232390 CTATAGAAATAGATGGAATAGGG - Intronic
1060683693 9:125588589-125588611 CAGTGGAGATAGAAGTGAGATGG - Intronic
1060941137 9:127543462-127543484 CTGTGGAAACATCTGGAAGATGG + Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062714639 9:138002246-138002268 CATTGGAAATCAATGGAGGAAGG + Intronic
1186149746 X:6661661-6661683 CATCAGAAAGAGATGGAAGAAGG - Intergenic
1186603924 X:11069005-11069027 CAGTGGAAAAAAAAAGAAGAAGG + Intergenic
1187073857 X:15914838-15914860 CAGGAGAAAGAAATGGAAGATGG - Intergenic
1187923449 X:24228550-24228572 CAGGGTAAATACATGGAAGTGGG + Intergenic
1192436192 X:71145181-71145203 CTGTGGAAATAGAGGGACCATGG - Intronic
1193505615 X:82338869-82338891 TTGTGGAAATAGATGGAGAAAGG - Intergenic
1193535303 X:82708040-82708062 CAGAGGAGAAAGCTGGAAGATGG + Intergenic
1194606824 X:95990874-95990896 CAATGCTAATAGATTGAAGAGGG - Intergenic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195172986 X:102286756-102286778 CATTGAAAATGGATGGAGGAAGG - Intergenic
1195185880 X:102400339-102400361 CATTGAAAATGGATGGAGGAAGG + Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1196549456 X:117005377-117005399 AAGAGGAAATGGATGAAAGAGGG + Intergenic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1197894546 X:131297660-131297682 CACTTGAAATAGCTGTAAGATGG + Intronic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199785280 X:151099654-151099676 CATAGGAAAAAGATGGAAGCTGG - Intergenic
1200007146 X:153094658-153094680 CAGTGAAGGTAGATGGGAGAGGG + Intergenic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic