ID: 1088682056

View in Genome Browser
Species Human (GRCh38)
Location 11:112251935-112251957
Sequence GGTTTTAAAGGGATTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 1, 2: 5, 3: 29, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088682056_1088682066 8 Left 1088682056 11:112251935-112251957 CCACCCCCAATCCCTTTAAAACC 0: 1
1: 1
2: 5
3: 29
4: 341
Right 1088682066 11:112251966-112251988 AAAGTCTACTGTATCCATTAAGG 0: 1
1: 0
2: 0
3: 17
4: 244
1088682056_1088682068 22 Left 1088682056 11:112251935-112251957 CCACCCCCAATCCCTTTAAAACC 0: 1
1: 1
2: 5
3: 29
4: 341
Right 1088682068 11:112251980-112252002 CCATTAAGGCTTTGTGTGAGTGG 0: 1
1: 0
2: 1
3: 7
4: 112
1088682056_1088682069 23 Left 1088682056 11:112251935-112251957 CCACCCCCAATCCCTTTAAAACC 0: 1
1: 1
2: 5
3: 29
4: 341
Right 1088682069 11:112251981-112252003 CATTAAGGCTTTGTGTGAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088682056 Original CRISPR GGTTTTAAAGGGATTGGGGG TGG (reversed) Intronic
901107245 1:6766101-6766123 GGTTATAAAGGGGTTAGGGGTGG - Intergenic
901386894 1:8916263-8916285 GGTTGTCAAGGGATGGGGAGGGG + Intergenic
901631501 1:10650338-10650360 TGTTTAAAAGGGGATGGGGGAGG - Intronic
902297323 1:15476577-15476599 GGATGTAAAGGGAGTGGGGCAGG - Intronic
902551080 1:17219959-17219981 GGATTGAAAGGGAGTTGGGGAGG + Intronic
902978470 1:20106689-20106711 GGTTTTTAAGGGTTTTGGAGTGG - Intergenic
903805964 1:26005838-26005860 GGTTGCAATGGGAGTGGGGGTGG + Intergenic
904568312 1:31441883-31441905 GTTTATAAAGGAATTGGGAGAGG + Intergenic
905123510 1:35701099-35701121 GTTTTTCAACGGACTGGGGGAGG - Intergenic
905370213 1:37479043-37479065 GTCTTTAATGGGAGTGGGGGAGG - Intronic
906027821 1:42689592-42689614 TGTTTTAAAAGGAGTGGGAGGGG + Intronic
906199629 1:43951044-43951066 GGGCTGGAAGGGATTGGGGGAGG + Intronic
907701113 1:56789038-56789060 GGTCTTGAAGGCTTTGGGGGAGG + Exonic
908521497 1:64947585-64947607 TGTCTTAAGGGGGTTGGGGGAGG - Intronic
908896994 1:68911840-68911862 GGTTTTAAGGGGATTTATGGAGG - Intergenic
909198629 1:72659413-72659435 GCTGTCCAAGGGATTGGGGGTGG - Intergenic
910289323 1:85584769-85584791 GCTTTTAAAAGGAATGGAGGAGG + Intergenic
912434220 1:109648461-109648483 GGTTTTCAGGGGATCGGGAGAGG + Intergenic
912725024 1:112051213-112051235 GGTTAGAAAGGGATTAGGCGTGG + Intergenic
912749068 1:112270448-112270470 GGTTGGCAAGGAATTGGGGGAGG + Intergenic
913480610 1:119285684-119285706 GGTTTTAAGGGGATTATGGAGGG - Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914348461 1:146819678-146819700 AGTATTGCAGGGATTGGGGGTGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914814873 1:151056039-151056061 GGTTTCTCAAGGATTGGGGGAGG - Intronic
915572208 1:156750939-156750961 GGTCTTAAAGGGGGTGGCGGCGG + Intronic
915713501 1:157923211-157923233 GTTTTTAAAGTGGCTGGGGGAGG + Intergenic
916611746 1:166398284-166398306 GGATGAAAAGGGATTGGGGGAGG + Intergenic
916965901 1:169942911-169942933 TTTTTTAAAGGGGTGGGGGGGGG - Intronic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917208880 1:172610322-172610344 GTATTTGAAGGGTTTGGGGGAGG + Exonic
918009853 1:180576699-180576721 GGTTTTTAAGGGTTTTGGAGTGG - Intergenic
919591070 1:199503396-199503418 GGTTTCCAAGGGCTTGAGGGAGG + Intergenic
919762091 1:201104353-201104375 GGTTTTCAAGGGATTGGGGAGGG - Intronic
920019687 1:202945988-202946010 GGTTACAAAGGGGTGGGGGGGGG - Intronic
920314183 1:205065933-205065955 GGTTTTAAGGGAGTTGGGGTAGG - Intronic
921151188 1:212404400-212404422 GTATTTAAAAGGATTGGGGCTGG - Intronic
921798453 1:219374888-219374910 GGTTTTAAAGAGTTTTGGAGTGG - Intergenic
921871762 1:220148091-220148113 GTTTTGAAAGGGAATGGCGGAGG + Intergenic
923369964 1:233299966-233299988 GAGTTTAAAGGGATTAGGTGAGG - Intergenic
923688388 1:236170074-236170096 GGTTTGACTGGGGTTGGGGGAGG + Intronic
923863272 1:237913940-237913962 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
924207590 1:241729364-241729386 GGTTATAAATGGGTTGGAGGAGG - Intronic
924556685 1:245124854-245124876 GGTTTTTAAGGGTTTGGGAGTGG - Intronic
1062930876 10:1351669-1351691 GGTTTTAATGGGATGGTGAGGGG - Intronic
1063668376 10:8080033-8080055 TGTTTTGAGGGGATTGGGTGTGG + Intergenic
1064376663 10:14802557-14802579 TTTTTTAAAGGGATTGTAGGGGG + Intergenic
1064828788 10:19438125-19438147 GGTTTTTAAGGGTTGGGGGAGGG - Intronic
1065207830 10:23374081-23374103 GGTTTTCAAGGGGTTTGGAGTGG - Intergenic
1065753104 10:28906593-28906615 TGTTTTACATGGAGTGGGGGCGG - Intergenic
1066242659 10:33553231-33553253 GGTTTTTAAGGGCTTTGGAGTGG - Intergenic
1066271446 10:33828209-33828231 GTTTTTAAAGGGTTTCGGAGTGG + Intergenic
1066818599 10:39455290-39455312 AGGTTTAAAGGGATTAAGGGCGG - Intergenic
1067179816 10:43976383-43976405 GGTTTCCAAGGGCTGGGGGGAGG - Intergenic
1067249277 10:44573786-44573808 GCTCTGAGAGGGATTGGGGGCGG - Intergenic
1069250625 10:66261906-66261928 GGTTTTTAAGGGTTTTGGAGTGG - Intronic
1069411913 10:68162821-68162843 GGTTTTTAAGGGTTTTGGAGTGG + Intronic
1069756851 10:70778748-70778770 GATCTTAAAGGGAAAGGGGGAGG + Intronic
1070858455 10:79628860-79628882 CGTTCTACAGGGATGGGGGGTGG + Intergenic
1072341194 10:94452447-94452469 GGTTTCCAGGGGATTGGAGGAGG - Intronic
1072863531 10:99032461-99032483 GGTTTGAAAGGGATGGGGCAGGG - Intronic
1073039212 10:100588814-100588836 GGTTGCCAAGGGTTTGGGGGAGG + Intergenic
1073075921 10:100825929-100825951 GGTTTTAAAGAGGTGGGGTGAGG + Intronic
1075710604 10:124528657-124528679 GATTTTAAAGGCAGTGGGGAAGG - Intronic
1076708903 10:132320381-132320403 GGTTTTAAAGGGACAGTGAGGGG + Intronic
1078346285 11:10552252-10552274 GGTTTTTAAGGGTTTCGGAGTGG + Intergenic
1078529005 11:12121912-12121934 GGTATTGATGGGATTTGGGGTGG + Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079479901 11:20868366-20868388 GGTTTTCAAGTGCTGGGGGGAGG + Intronic
1079655371 11:22980250-22980272 GGTTTTAAAGGGGATTGTGGAGG + Intergenic
1080715436 11:34795755-34795777 GGTTTTAGAGGGGTTGGAGGAGG + Intergenic
1081643882 11:44776885-44776907 TGTTTTAAAGGGATTGGGTTTGG + Intronic
1081657976 11:44869838-44869860 GGTTTTAATGAGGTTGGGGTGGG + Intronic
1081836484 11:46159815-46159837 TGTTTTCAAGGAAGTGGGGGTGG + Intergenic
1082836961 11:57658066-57658088 GGGTTTACAGGAATTGTGGGAGG - Intronic
1084292223 11:68180796-68180818 GTTTTTAAATGGAGTGGGAGCGG - Intronic
1084728188 11:71055762-71055784 GGTTTTCTAGGGGCTGGGGGAGG + Intronic
1084975867 11:72797938-72797960 AGTTTTACAGGGTTTGGGAGGGG - Intergenic
1086833613 11:91596029-91596051 GGCCTTAAATGGATTGGGTGAGG + Intergenic
1087540092 11:99505682-99505704 TGTTACATAGGGATTGGGGGAGG - Intronic
1088364354 11:109023372-109023394 AATTTTAAAAAGATTGGGGGAGG - Intergenic
1088682056 11:112251935-112251957 GGTTTTAAAGGGATTGGGGGTGG - Intronic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089895826 11:121929184-121929206 GAATTAAAAGGGAGTGGGGGAGG - Intergenic
1091549161 12:1524741-1524763 TGTTTTTAAGAGATGGGGGGGGG + Intergenic
1093260017 12:16924413-16924435 GGTTTTTGGGGGATTGTGGGGGG - Intergenic
1093297822 12:17412838-17412860 GGCTTTGAGGGAATTGGGGGTGG + Intergenic
1093358151 12:18195271-18195293 GGTTTCGAAAGGGTTGGGGGGGG + Intronic
1094105748 12:26809661-26809683 GGTTTTCAGGGGCTTGGCGGGGG + Intronic
1096356789 12:50948211-50948233 AGTTGTGAAGAGATTGGGGGAGG - Intergenic
1096713070 12:53471987-53472009 AGTTTTCAAGGGGTTGGTGGGGG + Intronic
1098915199 12:76250072-76250094 GGTTTTAGGGGGATGGGGGAGGG + Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1102409329 12:112703759-112703781 GTTTTTAAAGGTTTTGGGGTGGG - Intronic
1102409330 12:112703760-112703782 GGTTTTTAAAGGTTTTGGGGTGG - Intronic
1102447281 12:113013223-113013245 GGTTTTTAAGGGTTTGGGAGTGG + Intergenic
1102907086 12:116685038-116685060 GGTTGTCATGGGATTGGGGCTGG + Intergenic
1103673086 12:122634258-122634280 GGGTTTGAAGAGCTTGGGGGTGG + Intergenic
1104099018 12:125588730-125588752 GGTTTTAAAGGGAGTTTTGGGGG + Intronic
1106288782 13:28341724-28341746 AATTTGAAAGGGATTGGGGGAGG - Intronic
1106663469 13:31826825-31826847 GGTTTTTAAGGGTTTTGGGGTGG - Intergenic
1107330164 13:39291088-39291110 GGTTTTTAAGGGTTTTGGAGTGG - Intergenic
1108409352 13:50131153-50131175 GCTTTAAAAGGGATGGGGGATGG - Intronic
1108737031 13:53294913-53294935 GGTTTTTAAGGGTTTTGGAGAGG + Intergenic
1109853481 13:68099738-68099760 GGTTTTATGGGGATTGTGGTGGG + Intergenic
1111839623 13:93433748-93433770 GGTTTTCCAGGGGTTGGTGGAGG + Intronic
1112020826 13:95369635-95369657 GGTTTTTAAGGGTTTTAGGGTGG + Intergenic
1112246885 13:97743382-97743404 GGTTTGTAAGGGTTTGGGAGTGG + Intergenic
1114221796 14:20703496-20703518 GGTTTTAAAGGGATGGTAAGGGG - Intergenic
1114482717 14:23045510-23045532 GTTTTTAATGAGTTTGGGGGAGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1116003588 14:39269346-39269368 GGTTGTCAAGGGATGAGGGGTGG - Intronic
1118019494 14:61695921-61695943 GGCGTTAATGGGATTGGGGGGGG + Intronic
1120080574 14:80211544-80211566 GGTGATAAAGGGGGTGGGGGAGG + Intronic
1121224877 14:92314237-92314259 GGTTAAAAAAGGGTTGGGGGTGG + Intergenic
1125782521 15:42282598-42282620 GGTTTTAAAGGTGTAGGGGCAGG - Intronic
1128794284 15:70453514-70453536 GGTTATCAGGGGTTTGGGGGAGG - Intergenic
1129281939 15:74492210-74492232 GGAATTGAAGGTATTGGGGGTGG + Intergenic
1129467866 15:75733985-75734007 GGTTTTAAAGGTCATGGGGAGGG + Intergenic
1129797831 15:78391540-78391562 GAGTTTAAGGGGGTTGGGGGTGG + Intergenic
1130244904 15:82237990-82238012 GGTTAAAAAGGGTTTGAGGGTGG + Intronic
1130455727 15:84105115-84105137 GGTTAAAAAGGGTTTGAGGGTGG - Intergenic
1130986668 15:88849047-88849069 GGGTGCAAAGGGATTGGAGGGGG + Intronic
1131016754 15:89064015-89064037 GGTTGTCAGGGGCTTGGGGGAGG - Intergenic
1131236601 15:90702381-90702403 GGCTTTAATGTGATTTGGGGGGG - Intergenic
1131998261 15:98154420-98154442 GGTTTTTAAGGGTTTTGGAGTGG - Intergenic
1133103287 16:3492045-3492067 GGTTTAAAAGTGTTTGGCGGTGG - Intergenic
1134391247 16:13822295-13822317 GGTATTGGAGGGTTTGGGGGTGG - Intergenic
1134855376 16:17514377-17514399 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1135070503 16:19347566-19347588 GGTTATCAGGGGCTTGGGGGAGG - Intergenic
1136291695 16:29276797-29276819 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1137464828 16:48698404-48698426 GGTTTTAAGCGGGTGGGGGGAGG + Intergenic
1137507638 16:49068285-49068307 GGTTTTTAAGGGGATGGTGGAGG + Intergenic
1137845868 16:51687439-51687461 GGGATGAAAGGGATTTGGGGAGG + Intergenic
1138832276 16:60389269-60389291 GTTGTTTCAGGGATTGGGGGGGG + Intergenic
1139283003 16:65785805-65785827 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1139749731 16:69102318-69102340 TGTTTTTAAGTGATTGGGTGTGG + Intergenic
1140040009 16:71400783-71400805 GGTTGTCAAGGGGTTAGGGGTGG + Intergenic
1140523898 16:75606037-75606059 TGTTTTTTAGAGATTGGGGGGGG + Intronic
1140965897 16:79965683-79965705 TGTTTTAGAGGGATGGGGAGTGG + Intergenic
1142065845 16:88062177-88062199 TCTTTTAAAGGCATGGGGGGTGG + Intronic
1142097577 16:88250741-88250763 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1143413410 17:6726631-6726653 GGATTCAAAGGGATTCAGGGAGG + Intergenic
1143751764 17:9033247-9033269 GGTTTAAAAAGGATTGGGCCGGG - Intronic
1143875756 17:9989558-9989580 TTTTCTAATGGGATTGGGGGAGG + Intronic
1146315972 17:31807087-31807109 ATTTTTCAATGGATTGGGGGTGG - Intergenic
1146533666 17:33631646-33631668 GAAGTTAAAGGCATTGGGGGTGG + Intronic
1147249955 17:39147341-39147363 GGTTTTATGGGGTTTGGGGTGGG - Intronic
1147702092 17:42402723-42402745 TTGTTTTAAGGGATTGGGGGAGG - Exonic
1147792356 17:43021598-43021620 GGTTTTAATGGGGGGGGGGGGGG + Intronic
1149732352 17:58958877-58958899 ATTTTAAAAGGGATTGGGGCTGG - Intronic
1150347969 17:64419244-64419266 TATTTTAAAGGTGTTGGGGGTGG - Intergenic
1151135973 17:71945983-71946005 GGTTTTATAGTGTGTGGGGGGGG + Intergenic
1151279525 17:73062729-73062751 GTTTTTCCACGGATTGGGGGTGG + Intronic
1151479552 17:74362083-74362105 GGTGGTAAGGAGATTGGGGGAGG - Intergenic
1151826313 17:76526558-76526580 GGTTTTGTGGGGGTTGGGGGAGG - Intergenic
1152933078 17:83120130-83120152 GGTTGGGGAGGGATTGGGGGAGG + Intergenic
1153309071 18:3660176-3660198 TTTTTTAAAAGGATTGGGGGTGG + Intronic
1153471379 18:5450163-5450185 GGTTGCTAAGGGTTTGGGGGTGG + Intronic
1153802652 18:8684798-8684820 GGTTTTTAAGGGTTTGGAGTGGG + Intergenic
1153833739 18:8945790-8945812 GGTTTTTAAGGGTTTGGAGTGGG - Intergenic
1154266990 18:12887238-12887260 GGTGTTAGAGGGCTTGGGGCTGG - Intronic
1155935305 18:31747143-31747165 GGTTAGAAAGGGACTGGGGCAGG - Intergenic
1157156744 18:45275085-45275107 GCTTGGAAAGGGGTTGGGGGTGG + Intronic
1158411138 18:57207005-57207027 GGCTTTCAAAGGATTGGGTGAGG + Intergenic
1158984863 18:62803949-62803971 GGTTCTATAGATATTGGGGGTGG + Intronic
1159927414 18:74281619-74281641 GGTTTAAAAGGGAATGGAGGAGG + Intronic
1160574505 18:79844381-79844403 GGTTGCCAGGGGATTGGGGGTGG + Intergenic
1162246796 19:9407744-9407766 GATTTAAAAGTGATTTGGGGCGG + Intergenic
1165145883 19:33729777-33729799 GGTTTTTAAGGGTTTTGGAGTGG + Intronic
1166017734 19:39995672-39995694 CATTTTTAAGGGATTTGGGGGGG + Intronic
1166413463 19:42573593-42573615 GGTTCCAAAGGTATTGCGGGTGG + Intergenic
1166677304 19:44747940-44747962 GGGTCTAAAGGGGCTGGGGGTGG - Intronic
925433741 2:3818680-3818702 GGTTTTAAAGGGATGGTAAGGGG + Intronic
926633735 2:15159597-15159619 GGTTATTAAGGGCTGGGGGGAGG + Intergenic
927891547 2:26753430-26753452 GGTTTTTAAGGGTTTTGGAGAGG + Intergenic
929283948 2:40114764-40114786 AGTTTTAAAGTGATTGGGGGAGG + Intronic
929411260 2:41699323-41699345 TATTTAAAAGGGATTTGGGGAGG - Intergenic
930099548 2:47592231-47592253 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
930749475 2:54919247-54919269 CTTTTGAAAAGGATTGGGGGGGG - Intronic
930958885 2:57234710-57234732 GCTTTGAACGGGATTAGGGGTGG - Intergenic
930997992 2:57745064-57745086 GGTTATAAGGGAATGGGGGGTGG + Intergenic
931798955 2:65740180-65740202 GGTTTGCATGGGATTGGGGGTGG + Intergenic
933283655 2:80360132-80360154 TGTTTTGAAGGGATTGGAAGAGG + Intronic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
934649672 2:96083734-96083756 GGTCTTGCAGGGATTGGGGGTGG - Intergenic
936342737 2:111650711-111650733 GTTATTGATGGGATTGGGGGAGG + Intergenic
936666389 2:114601476-114601498 TGTTTTAAAGGGATTGGGGAGGG + Intronic
936727601 2:115339790-115339812 GGTTGCCAAGGGATTGGGTGGGG + Intronic
937878751 2:126849581-126849603 GACTCTAAAGGGATGGGGGGAGG - Intergenic
939586459 2:144012074-144012096 GGTTGGAAAGGAGTTGGGGGTGG - Intronic
939829860 2:147058643-147058665 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
940183070 2:150955982-150956004 GGTTTTAATGGGATGGTAGGGGG - Intergenic
940382063 2:153026393-153026415 GGTTGACAAGGGTTTGGGGGAGG - Intergenic
941996682 2:171607798-171607820 TTTTTTTAAGAGATTGGGGGGGG - Intergenic
942220447 2:173763629-173763651 GCTTTTAAAGGGAGTTGGGTGGG - Intergenic
942455426 2:176135290-176135312 GTCTTTAAAAGGATGGGGGGTGG + Intergenic
945454508 2:210034536-210034558 TGATTTAAAGGGATGGGGTGGGG + Intronic
945577229 2:211546947-211546969 GGTTGTAAAGGGATGGGATGAGG + Intronic
945982769 2:216327430-216327452 GGTTTTAAATTGGCTGGGGGTGG - Intronic
946233465 2:218307217-218307239 GTTTTTCCAGGGACTGGGGGAGG + Intronic
947009979 2:225554666-225554688 GGGATTGTAGGGATTGGGGGAGG + Intronic
948881968 2:240863526-240863548 GGTTTTGGTGGGATTGGGTGAGG - Intergenic
1169247322 20:4033816-4033838 AGGGTTAAATGGATTGGGGGCGG + Intergenic
1169743307 20:8918410-8918432 GGTTTCTAAGGGTTTGGGAGTGG - Intronic
1169909743 20:10637602-10637624 GGTTTTAAAGGGTTTGGAATTGG - Intergenic
1170157305 20:13280396-13280418 GTTTTGAAATGTATTGGGGGGGG - Intronic
1171885136 20:30646561-30646583 GGGTTGGAGGGGATTGGGGGTGG - Intergenic
1172750153 20:37245111-37245133 GGTTTTATAGGGATTAGAGGAGG + Intergenic
1174042337 20:47708909-47708931 GGTTTTTAAGGGTTGGGGGTTGG - Intronic
1175303964 20:57963339-57963361 GGTTGCCAAGGGCTTGGGGGAGG + Intergenic
1175406021 20:58729270-58729292 GGTTTCCAAGGGATAGGGGAAGG + Intergenic
1175718452 20:61271152-61271174 GGTTTTAAAGGGATGGACTGGGG + Intronic
1177476477 21:21630572-21630594 GGTTGCCAAGGGTTTGGGGGAGG + Intergenic
1177514994 21:22137927-22137949 GGTTGTCAAGGGTTTGTGGGAGG + Intergenic
1178493633 21:33070107-33070129 GGGTTTAAAGGGGTAGGGCGCGG + Intergenic
1178496603 21:33091383-33091405 GATTTTAAATGGATTGAGTGGGG - Intergenic
1180114103 21:45685226-45685248 GGTTTTAAAGGTTGTGGGGAAGG + Intronic
1180145328 21:45915513-45915535 GGTCTTAAAGCCACTGGGGGAGG + Intronic
1182943102 22:34297027-34297049 GGTTTTTAAGGCTTTTGGGGAGG + Intergenic
1183858950 22:40655156-40655178 GTTTTTAAAAGGTATGGGGGAGG - Intergenic
1184962558 22:47942008-47942030 GGTTTAAGGGGGCTTGGGGGAGG + Intergenic
949981400 3:9504020-9504042 TTTTTTTAAGAGATTGGGGGAGG - Intronic
950606086 3:14082008-14082030 GGTTTTTAGGGGACTGGGGCAGG - Intronic
951107569 3:18762736-18762758 GGATATAAAGGGATGGGGTGAGG - Intergenic
951129525 3:19025265-19025287 GGGTTTCAACTGATTGGGGGAGG - Intergenic
951263136 3:20535643-20535665 GGTTGTGGAGGGGTTGGGGGTGG - Intergenic
952559706 3:34577076-34577098 GATTTTGAAGGGATTGGAGATGG + Intergenic
952723849 3:36561221-36561243 GATTTTGTAGAGATTGGGGGAGG - Intergenic
954318677 3:49815813-49815835 GCTTTTGTAGAGATTGGGGGTGG + Intergenic
954715847 3:52526390-52526412 GGTTCTAAAGGCCTTGGGGCTGG - Intronic
955145923 3:56319455-56319477 GGTTGTCAAGGGCTAGGGGGAGG + Intronic
955237199 3:57150047-57150069 GGTTTTGGAGGGATGGAGGGAGG - Intronic
956233383 3:67041453-67041475 GGTTTTAAAGGGATGGTAAGGGG + Intergenic
959693212 3:109221466-109221488 TGTTTTTAAGGACTTGGGGGAGG + Intergenic
960870564 3:122245486-122245508 GTTTTTAAAAGGATGGGGTGAGG + Intronic
962064063 3:131960814-131960836 GGTTTTAAGGGGATTATGGAGGG - Intronic
963243495 3:143035008-143035030 TGTTTTAAATGGGTGGGGGGAGG + Intronic
966121137 3:176521892-176521914 GCTTTTAAGGGGATTTGTGGAGG + Intergenic
969932164 4:10641251-10641273 GGTATGAAAGGGATGGGGAGTGG + Intronic
970446174 4:16124889-16124911 GATTGTCAAGGGATTGGCGGGGG - Intergenic
970593015 4:17576064-17576086 GGTTTTTAAGGGTTTTGGAGAGG - Intergenic
970661704 4:18292730-18292752 GGTTTTAAGTGGATGGGGGTTGG + Intergenic
971034127 4:22674945-22674967 GGTTTTAGAGAGATTAAGGGAGG + Intergenic
971127965 4:23775189-23775211 GGTTTTCAAGGGAATTGGGAGGG - Intronic
973751535 4:54024975-54024997 GCTTTGAACGGGATTAGGGGCGG - Intronic
974633929 4:64533762-64533784 GGTTGTAATGGGAATAGGGGTGG + Intergenic
975850048 4:78562968-78562990 GATTACAAGGGGATTGGGGGAGG + Intronic
976318721 4:83687053-83687075 GGTTTTAAAGGGTCTGGGTGAGG - Intergenic
978036038 4:103996229-103996251 TGTTTTATAGGGATTAGAGGAGG - Intergenic
978325881 4:107553780-107553802 GGTTTTTAAGGGTGTGGGGATGG + Intergenic
978815548 4:112900776-112900798 GGCATTAAAGGGCTTGGTGGAGG - Intronic
980382616 4:132043877-132043899 GGCTTTAAATTGATTGGAGGAGG + Intergenic
980582048 4:134768242-134768264 GGTTTTTAATGGATTGGATGAGG + Intergenic
980642067 4:135594405-135594427 GGTTGTCAGGGGCTTGGGGGAGG - Intergenic
981751647 4:148098023-148098045 GGTTTTTAAGGGCTTGGGAGTGG - Intronic
984819197 4:183865307-183865329 GGTTTTAAAGTGACTGGGGTGGG + Intronic
987006857 5:13719423-13719445 AGTTTTAATGGAATTTGGGGAGG - Intronic
987510199 5:18827528-18827550 TGTGTTAAAGGGTTTTGGGGTGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989655679 5:43745426-43745448 GGTTTTAAATGGATTAAGGGCGG - Intergenic
990828655 5:59931567-59931589 GGTTTTCATGGGATTGGGACTGG - Intronic
991351536 5:65724265-65724287 GGTTAACCAGGGATTGGGGGAGG - Intronic
992778756 5:80109852-80109874 GGTTTTATAGGGGCTGGGGGAGG - Intergenic
994045372 5:95303222-95303244 GGTTGTAAAGGAATTGGGCCTGG - Intergenic
995728164 5:115203947-115203969 GGCTATTAAGGGATGGGGGGAGG - Intergenic
995835341 5:116395071-116395093 GTTTCTAAAGGGGTTGGGGTGGG - Intronic
995971933 5:117983216-117983238 GGTTTTAAAAAGAGTGGGGCAGG + Intergenic
996206502 5:120744391-120744413 GGTTGGAAGGGGATTGGGGAAGG + Intergenic
996870531 5:128187280-128187302 GGTTAAAAAGGTATTTGGGGGGG - Exonic
997512378 5:134462447-134462469 GGTTGTAAAGGGAGTGCTGGAGG - Intergenic
997610227 5:135210557-135210579 GGTTTTATGGAGTTTGGGGGTGG + Intronic
997950684 5:138240377-138240399 GGTTTTAAAGGAATCAGGGAAGG + Intergenic
1000233209 5:159334600-159334622 GGTTTTTAAGAGTTTGGGAGTGG - Intergenic
1000771277 5:165357995-165358017 GGTTTTAAAAGGCTTGGGCTGGG - Intergenic
1001616636 5:173048154-173048176 GGTTTTTAAGGGTTTTGGAGTGG + Intergenic
1001616791 5:173049228-173049250 GATTTTAATTGGATTGGGGCAGG + Intergenic
1001947787 5:175795143-175795165 TGTTATAGAGTGATTGGGGGAGG + Intergenic
1002220517 5:177676398-177676420 GGTTTTTCAGGGGTTGGGGAAGG + Intergenic
1003154177 6:3577271-3577293 GGATTTAAAGGTATTGATGGAGG + Intergenic
1003688621 6:8329282-8329304 GCTTTTAAAGGGATTTGTGTAGG + Intergenic
1004087821 6:12468805-12468827 AATTTTAAAGGGAATGGGGCAGG - Intergenic
1004436365 6:15598691-15598713 GGGTTGAGGGGGATTGGGGGTGG + Intronic
1005623111 6:27638202-27638224 GGATTTTAAGGGATTTGGAGTGG + Intergenic
1006082895 6:31577572-31577594 GGTAATAAAGGGATTGGGGCAGG - Exonic
1006867296 6:37219191-37219213 TGTTTAAAATAGATTGGGGGTGG + Intronic
1007830597 6:44635409-44635431 GGGGTTAAGGGGATGGGGGGTGG - Intergenic
1008099283 6:47373886-47373908 AGATTAAAAGGGATTGGGGCAGG + Intergenic
1008915954 6:56786815-56786837 GGTTAAAAAGGTATTGGGGTTGG - Intronic
1011757250 6:90512779-90512801 GGTTTTAAAAGACATGGGGGTGG + Intergenic
1012102018 6:95101955-95101977 GGTTGCAAAGGGGTTGTGGGTGG - Intergenic
1013374823 6:109504182-109504204 GTTTTTATAGAGATTGGAGGGGG - Intronic
1013637333 6:112041609-112041631 AGTTTTATTGGGAATGGGGGTGG + Intergenic
1016671396 6:146712914-146712936 GGTTTTCATGGGCTGGGGGGAGG - Intronic
1016846586 6:148574086-148574108 GGTTTTAATGGCATTAGGGGCGG + Intergenic
1019051661 6:169188307-169188329 GGTTTTGAAGGGTTTTGAGGAGG + Intergenic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1020108030 7:5431337-5431359 TGTTTTATAGAGATTGGTGGGGG + Intronic
1020402751 7:7796851-7796873 GGTTTTTAAGGGTTTTGGAGTGG - Intronic
1021465866 7:20943064-20943086 GGTTTCCAGGGGCTTGGGGGAGG + Intergenic
1021677221 7:23093181-23093203 TGTTTGCCAGGGATTGGGGGTGG - Intergenic
1022870485 7:34472380-34472402 GGATTCAAAGAGTTTGGGGGGGG + Intergenic
1023300737 7:38768194-38768216 GGTTCTGAAAGGATTTGGGGTGG + Intronic
1023347205 7:39283433-39283455 GGTTGTCAAGGGCTTGGGAGTGG - Intronic
1024298222 7:47863236-47863258 GGGTTGGAAGGGGTTGGGGGAGG + Intronic
1026395332 7:69947107-69947129 GGGTTTAAAGGGATTGAGGGAGG + Intronic
1026527250 7:71165185-71165207 GGTTTTTCAGGGATTGGGAAGGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027168110 7:75850304-75850326 AGTTTTCAAGGGATTGAGGTAGG + Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027194682 7:76021612-76021634 GGTTTTTAAGGGGATTGGGGAGG - Intronic
1027663901 7:81020684-81020706 GGTGTTAAAGGGTTTGGTGATGG - Intergenic
1028155750 7:87427473-87427495 CTTTTTAATGGGAATGGGGGTGG + Intronic
1028290278 7:89056930-89056952 GGTTTTAAAGGTTTTGGAGTGGG + Intronic
1031429033 7:121643230-121643252 TGTTTTAATGGGTTTGGGGGGGG + Intergenic
1033358444 7:140620336-140620358 TGTTTAAAAGGGGTGGGGGGGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034846443 7:154450711-154450733 GGGTTTAGAGGGGCTGGGGGAGG + Intronic
1034925740 7:155120062-155120084 GGTTTTAAAGGGATCATGGAGGG - Intergenic
1037058556 8:14477288-14477310 GGTTTTAAAGGGTTTTGCTGTGG - Intronic
1038029074 8:23621272-23621294 GGTTTTAGAGGGAGTGTGGATGG - Intergenic
1038327174 8:26579958-26579980 TTTTTTAAAGGGTGTGGGGGGGG - Intronic
1039013300 8:33119371-33119393 GAGTTTAAAGGGAATGGAGGAGG - Intergenic
1039380627 8:37081568-37081590 ACTTTTAAAGGGAATGGGGGAGG - Intergenic
1039435570 8:37557184-37557206 AGTTTTAAAGGGATTGGGGGGGG - Intergenic
1040648136 8:49422442-49422464 GGTTTTAATGGGATTGTAAGGGG - Intergenic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045851848 8:106709600-106709622 GGGTTTAATGGGGTTAGGGGAGG + Intronic
1045904038 8:107321453-107321475 CCTTTTAAAGGGAATGGGGTAGG - Intronic
1046046961 8:108976079-108976101 GGTTTTGGAGGTATTGAGGGTGG - Intergenic
1047465792 8:125112721-125112743 GGTTACCAAGGGATTGGGGAAGG + Intronic
1047559676 8:125973093-125973115 CATTTTAAAGGGCTTGAGGGAGG - Intergenic
1049595349 8:143480876-143480898 GGTGGTAAGGGGACTGGGGGAGG + Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1050377547 9:4988157-4988179 GGTCTAAAAGGGAGTGGGGAAGG - Intronic
1050530852 9:6588110-6588132 GGTTTAAAAGGGGGTGGGGGTGG + Intronic
1051341308 9:16113396-16113418 TGTTTTAAAGGGCTTAGGGAGGG - Intergenic
1053283639 9:36837080-36837102 GGATTTCTAGGGAATGGGGGTGG + Exonic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1055004999 9:71496346-71496368 GGTTATAAAGGGGGTGGGGTGGG - Intergenic
1055582659 9:77723764-77723786 GGTTTCCAAGGGTTAGGGGGAGG + Intronic
1056606848 9:88093025-88093047 GTTTTTAAGGGGATTTGTGGAGG - Intergenic
1057440287 9:95078043-95078065 GGTGGGAAAGGGAGTGGGGGTGG + Intronic
1058618656 9:106861700-106861722 GGTTTTAATTGGACTGGGAGCGG - Intergenic
1059442005 9:114313218-114313240 GATTTTCCAGGGGTTGGGGGAGG - Intergenic
1060108580 9:120890652-120890674 GATTTCAAAGGGCATGGGGGAGG + Intronic
1060382335 9:123188033-123188055 GGTTACTAAGGGCTTGGGGGTGG - Intronic
1061251722 9:129430262-129430284 AGTATTAAGGAGATTGGGGGAGG + Intergenic
1061282178 9:129603731-129603753 TTTTTTAAAGAGATGGGGGGGGG + Intergenic
1203563580 Un_KI270744v1:76190-76212 GGACTCAAAGGGATTGGAGGAGG - Intergenic
1186116827 X:6312725-6312747 GATTTTAAAAGAAATGGGGGAGG + Intergenic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1186494061 X:9997742-9997764 GGGTTTCCAGGGACTGGGGGAGG + Intergenic
1186635508 X:11400061-11400083 GGTGTTAAAGGGAAAGGGAGGGG + Intronic
1187099574 X:16179726-16179748 GCTTTGAACGGGATTAGGGGCGG + Intergenic
1188439228 X:30198297-30198319 GGCTTTAAAGAGAGAGGGGGAGG + Intergenic
1190722092 X:53157834-53157856 GGTTTTCAAGGGGATGGGGGTGG - Intergenic
1192170899 X:68854128-68854150 GGTTTTAGGGGGATGGGGAGGGG - Intergenic
1192394728 X:70767971-70767993 GGCTGGAAAGGGTTTGGGGGTGG + Intronic
1195311268 X:103633933-103633955 GCTTTTTAAGGCATTGGTGGTGG + Intergenic
1195314714 X:103666244-103666266 GCTTTTTAAGGCATTGGTGGTGG + Intergenic
1195465825 X:105177483-105177505 ATTTTTCTAGGGATTGGGGGAGG - Intronic
1196914020 X:120513410-120513432 GGTTTTAAAGGGTTTTGGAGTGG - Intergenic
1197326367 X:125099175-125099197 GGTTTTAAAAGGAATGGGGGAGG + Intergenic
1198250784 X:134877530-134877552 GGTCATAAAGGGATTTGGGATGG - Intergenic
1198614201 X:138436804-138436826 TGTTTTAATGGGATTTAGGGTGG + Intergenic
1199672994 X:150162114-150162136 GGTGGTAAAGGGATGGGAGGAGG + Intergenic
1200857762 Y:7958021-7958043 CATTGTAAAGGGATTGGTGGGGG + Intergenic
1201361299 Y:13152805-13152827 AGTTTTCCAGAGATTGGGGGGGG + Intergenic
1201622733 Y:15978720-15978742 CGTTGTAAAGGGATTGGCAGGGG + Intergenic