ID: 1088683500

View in Genome Browser
Species Human (GRCh38)
Location 11:112265463-112265485
Sequence CACTAGTCTGAGGAGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088683493_1088683500 7 Left 1088683493 11:112265433-112265455 CCAGACACGACCACTGATGGATG 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1088683500 11:112265463-112265485 CACTAGTCTGAGGAGCCCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 244
1088683496_1088683500 -3 Left 1088683496 11:112265443-112265465 CCACTGATGGATGCAGGGATCAC 0: 1
1: 0
2: 1
3: 17
4: 205
Right 1088683500 11:112265463-112265485 CACTAGTCTGAGGAGCCCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088683500 Original CRISPR CACTAGTCTGAGGAGCCCTG GGG Intronic
900641375 1:3689523-3689545 CAGCTGCCTGAGGAGCCCTGGGG - Intronic
902294021 1:15453950-15453972 AACTACTCTGAGGAGCCACGTGG - Intergenic
903162216 1:21497211-21497233 CACTTGCTTGGGGAGCCCTGGGG + Intergenic
903624687 1:24721933-24721955 CACCAGACTCAGGAGCCCAGCGG - Intergenic
904278113 1:29397302-29397324 CCCTAGGTTAAGGAGCCCTGGGG - Intergenic
905336259 1:37246712-37246734 CACTCTTCTGTGGAACCCTGGGG - Intergenic
905346360 1:37313641-37313663 CACTAAGCTGAGCATCCCTGGGG + Intergenic
905900143 1:41575978-41576000 CACTAGTCTGGGAACTCCTGGGG + Intronic
907554751 1:55334275-55334297 CACTTGTGGGAGGAGCCCTAGGG + Intergenic
907714777 1:56916570-56916592 CTGTGATCTGAGGAGCCCTGGGG + Intronic
908093046 1:60706839-60706861 CTTTAGTCGGAGGAGCCCTGGGG - Intergenic
909455243 1:75842686-75842708 CACTAGACCAAGGAGCCCTCTGG - Intronic
911278026 1:95887858-95887880 AACTAGTCTGAGAAGTCCTTAGG + Intergenic
913088304 1:115458995-115459017 CCCTGGTTTCAGGAGCCCTGGGG - Intergenic
913349545 1:117842541-117842563 GAATAGTCTCAGGTGCCCTGGGG + Intergenic
913362137 1:117993121-117993143 CCAGAGTCTGAGGATCCCTGGGG + Intronic
913450866 1:118991685-118991707 GGGAAGTCTGAGGAGCCCTGGGG + Intergenic
914378888 1:147098544-147098566 CACTAGACCAAGGAGCCCTCTGG + Intergenic
914488325 1:148131336-148131358 AACTTGTCTGTGGAGGCCTGGGG - Intronic
915309838 1:155001405-155001427 CACTAGTGGGAGGGGCCCTTTGG + Intergenic
917348782 1:174056318-174056340 CACCAGACTCAGGAGCCCAGGGG + Intergenic
917966362 1:180181465-180181487 CAGTAGTCAGAGGGGCCCTTTGG - Intronic
921253686 1:213320672-213320694 CACTGGTCTGATGATCCCGGAGG - Intergenic
922650695 1:227335603-227335625 CTCTGATCTGAGAAGCCCTGAGG - Intergenic
1066415208 10:35215013-35215035 CACGGGTGTGAGGAGCGCTGTGG - Intergenic
1067052801 10:43032786-43032808 CACTAGTCTGAGGAGCAAAAAGG + Intergenic
1067055496 10:43047494-43047516 CTCTGGCCAGAGGAGCCCTGTGG + Intergenic
1067067839 10:43113576-43113598 CACGAGCCTGGGGAGCCCCGGGG + Exonic
1067753380 10:48986135-48986157 TACTTTCCTGAGGAGCCCTGAGG - Intergenic
1069004080 10:63297892-63297914 CCCTGGCTTGAGGAGCCCTGAGG - Intronic
1069041746 10:63703156-63703178 CACTAGACTGTGAAGCCATGGGG + Intergenic
1070424560 10:76272751-76272773 CACATGGCTGAGGAGGCCTGAGG + Intronic
1070452599 10:76576979-76577001 CAATAGACTGAACAGCCCTGAGG - Intergenic
1072580714 10:96737580-96737602 CACATGTCTGAGGAGGCCTAAGG - Intergenic
1073289362 10:102405733-102405755 CTCTAGGCTGGGGAGCTCTGAGG - Intronic
1073791319 10:106943041-106943063 CACTAGTCAGAGGTGCTCAGTGG + Intronic
1076622858 10:131803871-131803893 AACTTGTCTGTGGAGGCCTGGGG + Intergenic
1077008883 11:371288-371310 CCCAAGTCAGGGGAGCCCTGGGG + Intronic
1077929075 11:6711731-6711753 CACTAGACCAAGGAGCCCTCTGG - Intergenic
1085467911 11:76736816-76736838 CACTAGGCTGTGGAGACCCGAGG + Intergenic
1086305292 11:85472943-85472965 CTCTGGCCTGAGGAGCCCTGAGG - Intronic
1086818646 11:91406388-91406410 CTTTAGTTTGGGGAGCCCTGAGG + Intergenic
1088683500 11:112265463-112265485 CACTAGTCTGAGGAGCCCTGGGG + Intronic
1089170832 11:116510412-116510434 GCCTGGTCTGAGGAGCACTGTGG - Intergenic
1089892859 11:121898682-121898704 CACTTGCCTTTGGAGCCCTGGGG + Intergenic
1093051147 12:14506378-14506400 GACTGGGCTGAGGAGGCCTGTGG - Intronic
1093537430 12:20238465-20238487 CACAAGGCTGAGGAGGCCTCAGG - Intergenic
1094707933 12:32932896-32932918 CACATGTCTGGGGAGCCCTCAGG - Intergenic
1096794302 12:54065188-54065210 CTGTAGTCTAAGGATCCCTGGGG - Intergenic
1098464910 12:70775661-70775683 CACTTCTCTAAGGAGCCTTGAGG - Intronic
1098935400 12:76473050-76473072 CACTAGACCAAGGAGCCCTCTGG + Intronic
1100734547 12:97512694-97512716 CACCAGACTCAGGAGCCCAGCGG + Intergenic
1101855585 12:108440123-108440145 CCCTAGGCAGAGCAGCCCTGAGG - Intergenic
1103014782 12:117485502-117485524 CATGAATCTTAGGAGCCCTGGGG + Intronic
1103976533 12:124706218-124706240 CAGAGGTCTGAGGAGCCCTGAGG - Intergenic
1104969212 12:132523622-132523644 CACTATACTCAGCAGCCCTGTGG + Intronic
1105622194 13:22079146-22079168 CACTGGTTTCAGGAGCTCTGAGG - Intergenic
1110140358 13:72121806-72121828 AACTTGTCTGTGGAGGCCTGGGG - Intergenic
1110925086 13:81140929-81140951 CACTTGTTTGTGGAGGCCTGGGG - Intergenic
1112077664 13:95931347-95931369 CACTAGACTCTGGAGCCCAGGGG + Intronic
1115068238 14:29291998-29292020 CTCATGTCTGAGGAGCCCTCAGG + Intergenic
1115068332 14:29293083-29293105 CTCATGTCTGAGGAGCCCTCAGG - Intergenic
1120194612 14:81468112-81468134 GACTGGTTTGAGGAGCCATGTGG - Intergenic
1121368734 14:93337762-93337784 CCCTAGTTTGGGGAGCCCTGAGG - Intronic
1122360737 14:101160785-101160807 CACAAGTCTAAGGATCTCTGTGG - Intergenic
1202893467 14_KI270722v1_random:181964-181986 CACTAGACCAAGGAGCCCTCTGG - Intergenic
1124840360 15:33235733-33235755 CACTAGTCTGGGGTGACCTGGGG - Intergenic
1124970337 15:34483576-34483598 CACATGTGTGAGGAGCCATGTGG + Intergenic
1125321910 15:38497988-38498010 TCCTAGTCTGAGGAACCCTGAGG - Intronic
1127827539 15:62718270-62718292 CACCATTAAGAGGAGCCCTGGGG - Intronic
1128265991 15:66266972-66266994 CTCTTGTCTCAGGAGCCCTTTGG - Intergenic
1128332207 15:66763253-66763275 CACCAGCCTGAGGAACCCTGAGG - Intronic
1128924786 15:71645268-71645290 CACAAGGCTGAGGAGGCCTCAGG + Intronic
1129596990 15:76973211-76973233 CTCAAGACTGAGGAGGCCTGGGG + Intergenic
1129892986 15:79084135-79084157 CCTCATTCTGAGGAGCCCTGGGG - Intronic
1131026008 15:89142164-89142186 CCCTAGCCTCAGGATCCCTGTGG + Intronic
1131262314 15:90893752-90893774 GACTTGTCTGAGGCCCCCTGAGG - Exonic
1133108115 16:3527410-3527432 CACTAGACCAAGGAGCCCTCTGG - Intronic
1133740694 16:8648872-8648894 CAGTAGTTTGAGAAGCTCTGGGG + Exonic
1134255945 16:12611524-12611546 CAATAGACAGAGCAGCCCTGAGG - Intergenic
1136048955 16:27637225-27637247 TACTAGAGTGAAGAGCCCTGAGG - Intronic
1137892614 16:52178566-52178588 CACAAGTCTCAGGAGCATTGAGG - Intergenic
1138414485 16:56863537-56863559 CAATAGACTGACAAGCCCTGGGG - Intergenic
1140661835 16:77196053-77196075 CTGTAGTCTGAGGAGTGCTGGGG - Intronic
1141597467 16:85106235-85106257 CACTAGTGTCCGGGGCCCTGTGG + Intronic
1142368958 16:89667205-89667227 CACTAGACCAAGGAGCCCTCTGG + Intronic
1142485564 17:245769-245791 CACTGGCCTGAGGGGCACTGTGG - Intronic
1143270627 17:5672291-5672313 CACTCGTGTGAGGAGCATTGAGG - Intergenic
1143464809 17:7129547-7129569 CACCAGTCTGAGAGGCCCAGAGG + Intergenic
1144850434 17:18241382-18241404 CACGAGGGTGAGGGGCCCTGGGG + Intronic
1145223498 17:21108114-21108136 CTCTAGACTAAGGAGCCCTCTGG + Intergenic
1145389603 17:22445307-22445329 CACTTGAATGAGGAGTCCTGAGG + Intergenic
1145974524 17:28976565-28976587 CCCAAGCCTGAGGAGCCATGGGG + Intronic
1146103779 17:30012087-30012109 CACTAGACCAAGGAGCCCTCTGG - Intronic
1148243616 17:46015947-46015969 CTCGAGTCTGAGAGGCCCTGTGG - Intronic
1150606043 17:66691816-66691838 CATTACTGTGAGGAACCCTGTGG - Intronic
1152120207 17:78413858-78413880 CAGTATTCTGAGGACGCCTGTGG + Intronic
1153359695 18:4180239-4180261 CACTAGTGTCAGGAGTGCTGGGG - Intronic
1155015360 18:21833160-21833182 CACAAATCTGAGGAGCAATGTGG - Intronic
1161640511 19:5419749-5419771 CCATAGTCAGAGCAGCCCTGAGG - Intergenic
1161769950 19:6225659-6225681 CACCAGGCTTAGGAGGCCTGTGG - Intronic
1163386379 19:17002485-17002507 CACTCTGCTGAGCAGCCCTGGGG + Intronic
1163661320 19:18579522-18579544 CATTAGTAGGAGGAGCCGTGGGG - Intronic
1164457098 19:28417904-28417926 CAGTCGACTGAAGAGCCCTGGGG - Intergenic
1165080465 19:33303363-33303385 CGCTAGTCTGGGGGGCCCCGCGG - Intergenic
1165264192 19:34646731-34646753 CAGGAGTGTGGGGAGCCCTGAGG - Intronic
1165341490 19:35215310-35215332 CAATAGACAGAGCAGCCCTGAGG - Intergenic
1166010526 19:39937655-39937677 GACTAGTCAGAGGGGCCCAGGGG - Intergenic
1167971439 19:53189892-53189914 CACTAGACCAAGGAGCCCTCCGG + Intronic
1167991026 19:53360697-53360719 CACTAGACCAAGGAGCCCTCTGG + Intergenic
1168480961 19:56719212-56719234 CACTAGACCAAGGAGCCCTCTGG + Intergenic
1168544907 19:57242239-57242261 CAGTTGGCTGAGAAGCCCTGAGG + Intronic
1168680368 19:58310926-58310948 CACTAGACCAAGGAGCCCTCTGG + Intronic
925096932 2:1212840-1212862 CCTTAGACTGAGGAGCCCTCAGG - Intronic
925606559 2:5666399-5666421 CACTCCTCTGAGGACACCTGTGG + Intergenic
925892668 2:8448432-8448454 CCCTAGACAGAGTAGCCCTGAGG - Intergenic
926685762 2:15696697-15696719 CACCAGACTCAGGAGCCCAGTGG + Intronic
927477686 2:23426355-23426377 CACTTGGCAGGGGAGCCCTGGGG - Intronic
930063385 2:47309393-47309415 AACTTGTCTGTGGAGGCCTGGGG + Intergenic
930115001 2:47710763-47710785 CACTTGTAGGAGCAGCCCTGTGG + Intronic
931824997 2:65991241-65991263 CATCAGTCTGTGGGGCCCTGTGG + Intergenic
932275705 2:70450847-70450869 CAGTGGTCTGAAGAGCCCAGAGG - Exonic
932408598 2:71530836-71530858 CCCTAAGCTGAAGAGCCCTGAGG + Intronic
932672946 2:73754056-73754078 CACTAGACCAAGGAGCCCTCTGG - Intergenic
933781189 2:85802537-85802559 CCCTTGTCATAGGAGCCCTGGGG + Intergenic
933802600 2:85975074-85975096 CACTGGTGGGAGGATCCCTGGGG + Intergenic
934543141 2:95193083-95193105 CGCTAGACTAAGGAGCCCTCTGG - Intergenic
934656178 2:96117734-96117756 CACCAGCCTGGGCAGCCCTGAGG + Intergenic
935366463 2:102296637-102296659 CACTAGGCTGAGGGGCCTTGGGG + Intergenic
935881811 2:107573036-107573058 CACTAGACCAAGGAGCCCTCTGG - Intergenic
935990505 2:108714859-108714881 AACTTGTCTGTGGAGACCTGGGG + Intergenic
937065514 2:119013876-119013898 CACTAGACTGTGAAGTCCTGAGG - Intergenic
943741232 2:191411645-191411667 CACTGGTCTGTGGTGCCCTTTGG + Intronic
945116018 2:206408991-206409013 CACAATTGTGAGGAGCCCTTTGG + Intergenic
947577408 2:231286967-231286989 CCCTAGTCGCAGGAGGCCTGGGG - Intronic
948135357 2:235632337-235632359 CACTACTCTGAGGCACCCCGAGG - Intronic
949034113 2:241808618-241808640 CACTTGTTTGTGGAGGCCTGGGG + Intergenic
1171408528 20:24930102-24930124 CTCTAGGCTGAAGTGCCCTGGGG - Intergenic
1172707351 20:36891903-36891925 CCCAGGTCTGAGGAGCTCTGAGG + Exonic
1173109281 20:40170416-40170438 CACTACCCTGGGTAGCCCTGGGG - Intergenic
1173992567 20:47314623-47314645 CACTAGTTTGAGGAACGCTAGGG + Intronic
1175139174 20:56847097-56847119 CACTAGCCTCAGGAGCTGTGGGG - Intergenic
1175533935 20:59694253-59694275 CAATGGTCTGTGGATCCCTGAGG - Intronic
1176071998 20:63231987-63232009 CCATAGTCAGAGTAGCCCTGAGG + Intergenic
1176338314 21:5619526-5619548 CACCAGTGTGGCGAGCCCTGTGG - Intergenic
1176339722 21:5682599-5682621 CACCAGTGTGGCGAGCCCTGTGG - Intergenic
1176471976 21:7114752-7114774 CACCAGTGTGGCGAGCCCTGTGG - Intergenic
1176495537 21:7496530-7496552 CACCAGTGTGGCGAGCCCTGTGG - Intergenic
1176505105 21:7641857-7641879 CACCAGTGTGGCGAGCCCTGTGG + Intergenic
1178074256 21:29000591-29000613 CACCAGACTCAGGAGCCCAGCGG - Intergenic
1178507202 21:33171706-33171728 TAGTAGTCTGAGGGCCCCTGGGG + Intergenic
1179233272 21:39524348-39524370 GACTTCTCTGAGGACCCCTGTGG + Intergenic
1180595140 22:16968058-16968080 CACAAGTCTTACCAGCCCTGTGG - Intronic
1181048506 22:20227803-20227825 CATCAGTCAGAGGTGCCCTGTGG + Intergenic
1181141776 22:20810744-20810766 CACCAGTCAGAGGCACCCTGAGG + Intronic
1182076500 22:27498997-27499019 CAGAAGCCTGTGGAGCCCTGGGG + Intergenic
1183054779 22:35298381-35298403 CACTTGTTTGAGCAGCCATGGGG - Intergenic
1183661648 22:39224946-39224968 GACTGTCCTGAGGAGCCCTGAGG - Exonic
1185154290 22:49183807-49183829 CACTGGTCTGAGGACTCCGGGGG + Intergenic
951300563 3:20990922-20990944 CACTTGTTTGTGGAGGCCTGGGG + Intergenic
952020028 3:29007870-29007892 CACAAGTCTGGGGAGGCCTCAGG + Intergenic
952405180 3:32998840-32998862 AAGAAGACTGAGGAGCCCTGGGG - Intronic
958796324 3:98710089-98710111 AACTGGTCTGACAAGCCCTGAGG - Intergenic
960703506 3:120459842-120459864 CACTTTTCAGAGGACCCCTGGGG + Intergenic
963994080 3:151686356-151686378 TACTAGTCTGAGGGACCCAGAGG + Intergenic
965747352 3:171939096-171939118 CACTAGCCTGAGATTCCCTGGGG + Intergenic
966117019 3:176477238-176477260 CACAAATCTGAGGATCCATGAGG - Intergenic
967303364 3:188038243-188038265 TACTCCTCTGAGCAGCCCTGGGG + Intergenic
967593299 3:191302407-191302429 CCATAGGCTGAGCAGCCCTGAGG - Intronic
968077143 3:195822233-195822255 CAATAGTCTCCTGAGCCCTGTGG - Intergenic
969153116 4:5187122-5187144 CAGTAGTCAGAGAAGCCATGGGG + Intronic
970894193 4:21083521-21083543 CTCTAGACTGAGAAGCCCAGAGG - Intronic
971373128 4:26034293-26034315 CTATAGTCTGGGGAGGCCTGAGG - Intergenic
971948881 4:33316928-33316950 CTCTCGTCTCAGGAGTCCTGAGG + Intergenic
972331574 4:38068997-38069019 CACTAGTTTTAGGAGCAGTGTGG - Intronic
976203890 4:82606458-82606480 CACTTGTCTAAGGAGCCCAGGGG + Intergenic
978714482 4:111825089-111825111 CACAGGGCTGAGGAGCCCTCAGG - Intergenic
978897743 4:113909675-113909697 CACAAGGCTGGGGAGGCCTGAGG - Intronic
978914325 4:114105198-114105220 AACAATCCTGAGGAGCCCTGGGG + Intergenic
982137483 4:152285402-152285424 CACCAGCATGAGGAGCCCTTCGG + Intergenic
984773247 4:183456674-183456696 CGAGAGTCTGCGGAGCCCTGAGG + Intergenic
985091066 4:186363204-186363226 CACTAGACCAAGGAGCCCTCTGG - Intergenic
985291393 4:188391540-188391562 CACTAGACCAAGGAGCCCTCTGG + Intergenic
985561638 5:589938-589960 CACAAGGCTGAGGAGGCCTCAGG + Intergenic
987332857 5:16872702-16872724 CATGATTCTGAGGAGCCATGTGG - Intronic
988182762 5:27818113-27818135 CCGTAGACTGAGCAGCCCTGAGG - Intergenic
988369350 5:30346204-30346226 CACCAGACTCAGGAGCCCAGCGG - Intergenic
991657870 5:68921305-68921327 CACTAGACTCAGGAGCCCAGTGG - Intergenic
993658761 5:90604006-90604028 CCCTAGTCTGAGGAGACATTAGG + Intronic
994052312 5:95376593-95376615 CACAAGGCTGAGGAGGCCTCAGG + Intergenic
996292252 5:121866108-121866130 CCCTGCTCTGTGGAGCCCTGTGG + Intergenic
996591470 5:125152797-125152819 CAGTAGGGTGAGGAGCCCTGGGG + Intergenic
998328557 5:141303873-141303895 CACTCGTCTGAGGGTCCCAGTGG + Intergenic
1003480406 6:6526001-6526023 CACTGAGCTGAGGAGCCATGAGG + Intergenic
1003564966 6:7215041-7215063 CCCTCATCTGGGGAGCCCTGGGG - Intronic
1005146870 6:22701581-22701603 CAGTAGTATGAGGAGCCTAGAGG + Intergenic
1005952933 6:30644784-30644806 CACCAGACTCAGGAGCTCTGAGG - Intronic
1006732567 6:36247211-36247233 CAGTAGTCTGTGGGGCCCTGAGG - Intronic
1007757680 6:44110841-44110863 GCTTAGTCAGAGGAGCCCTGGGG + Intergenic
1007980361 6:46149144-46149166 CACAAGGCTGAGGAGGCCTCAGG + Intergenic
1009684399 6:66937182-66937204 CCCTGGCTTGAGGAGCCCTGAGG - Intergenic
1011042248 6:83042630-83042652 CACCTCTCTGAGCAGCCCTGTGG - Intronic
1014263827 6:119251783-119251805 TACTACTCATAGGAGCCCTGTGG - Intronic
1015216344 6:130754871-130754893 CACTAGACTGAAGAGCCTTCCGG - Intergenic
1015245838 6:131073899-131073921 CACTTGGCTGGGGAGGCCTGAGG - Intergenic
1016739628 6:147513579-147513601 CAGTAGAGGGAGGAGCCCTGGGG + Intronic
1018038015 6:159898380-159898402 AACCAGTTTGAGAAGCCCTGTGG - Intergenic
1019169676 6:170125838-170125860 CAGGAGTCTGTAGAGCCCTGGGG + Intergenic
1019970889 7:4539820-4539842 AACTTGTCTGTGGAGGCCTGGGG - Intergenic
1021694685 7:23265233-23265255 GACGATTCTGAGAAGCCCTGGGG + Intronic
1023327615 7:39076767-39076789 AACTGCTCTGAGAAGCCCTGAGG - Intronic
1023639042 7:42239204-42239226 CACGAGACTCAGAAGCCCTGTGG + Intergenic
1025032275 7:55567636-55567658 CAGGTGTCTGAGGAGGCCTGTGG - Intronic
1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG + Intronic
1028401841 7:90433198-90433220 CCCTGGCTTGAGGAGCCCTGAGG + Intronic
1028739299 7:94253735-94253757 CATGAGACTGAGGAGCCCTTTGG + Intergenic
1029494232 7:100888657-100888679 CACGAGAGTCAGGAGCCCTGTGG - Exonic
1029546096 7:101211479-101211501 CACCAGTCAGAGGTGCCATGAGG - Intronic
1031851282 7:126867258-126867280 CACTAGTATGAAGGGCTCTGAGG + Intronic
1032491089 7:132325078-132325100 AACCAGTATGAGGAGCCCGGAGG - Intronic
1034579508 7:152030277-152030299 CACTAGACCAAGGAGCCCTCTGG + Intronic
1034632057 7:152538796-152538818 CACCAGACTCAGGAGCCCAGCGG + Intergenic
1035872866 8:3154589-3154611 CACCATGCTGAAGAGCCCTGCGG + Intronic
1037403535 8:18517912-18517934 CACCTGTCTGAGGAGGCCTCAGG + Intergenic
1038382001 8:27105071-27105093 CAGTAGTCTGAGGAACAATGAGG - Intergenic
1039497536 8:37992278-37992300 CACAGGTCTGAGGAGGCCTCAGG + Intergenic
1040018772 8:42721810-42721832 CAGTGGTCTCAGAAGCCCTGTGG + Intronic
1041179092 8:55229257-55229279 CATTGGTCTGAGGTGCCGTGTGG - Intronic
1041942608 8:63405300-63405322 AACTAGACTGAGGACACCTGGGG + Intergenic
1042941528 8:74113544-74113566 CACTATTCTGATGAATCCTGAGG - Intergenic
1044817052 8:96124160-96124182 CTTTAGTCTAAGGAGGCCTGTGG + Intergenic
1045272610 8:100674792-100674814 TAGGAGTCTGGGGAGCCCTGAGG - Intergenic
1045276189 8:100707887-100707909 CACTAGACCAAGGAGCCCTTTGG + Intronic
1046067455 8:109213700-109213722 CACTAGACCAAGGAGCCCTCTGG - Intergenic
1047822326 8:128535056-128535078 CACTGGGCTGAGGAGGCCTCAGG + Intergenic
1048324385 8:133427952-133427974 CCATAGTCAGAGCAGCCCTGAGG - Intergenic
1049195630 8:141314160-141314182 CACCAGTATGGGGAGCCGTGTGG - Intergenic
1049857159 8:144869849-144869871 CACTAGACCAAGGAGCCCTCTGG - Intergenic
1050975181 9:11928810-11928832 CACCAGACTCAGGAGCCCAGCGG + Intergenic
1051352736 9:16213786-16213808 GACAAGACTGAGGAGGCCTGGGG - Intronic
1051664072 9:19451718-19451740 CACAATTGTGAGGAGCCCTTTGG - Exonic
1060807723 9:126588084-126588106 CTCTAGGCTCAGGAGCCTTGGGG + Intergenic
1062484233 9:136766601-136766623 CACTAGACCAAGGAGCCCTCTGG - Intergenic
1062645457 9:137545802-137545824 CACTAGACCAAGGAGCCCTCTGG - Intronic
1187176298 X:16898855-16898877 CCCTAGTCAGAGCAGACCTGGGG - Intergenic
1187359048 X:18607292-18607314 GAATGGTCAGAGGAGCCCTGAGG + Intronic
1187487544 X:19718958-19718980 CACTAGGTGGAGGGGCCCTGTGG + Intronic
1187767062 X:22654263-22654285 CAGTAGTTTGGGGACCCCTGGGG + Intergenic
1188434479 X:30145238-30145260 CACTCCTCTCTGGAGCCCTGAGG - Intergenic
1196282322 X:113836448-113836470 AAAAAGTCTGAGGACCCCTGAGG - Intergenic
1196660843 X:118267104-118267126 CACAAGCCTGAGGAGGCCTCAGG - Intergenic
1197807959 X:130415595-130415617 CAATAGACCAAGGAGCCCTGGGG + Intergenic
1198287490 X:135206615-135206637 CACTAGACCAAGGAGCCCTCTGG - Intergenic
1198315237 X:135459524-135459546 CACTAGTCACAGGAGCCAAGAGG - Intergenic
1198998709 X:142606869-142606891 CACTAGACCAAGGAGCCCTCTGG + Intergenic
1201556378 Y:15267691-15267713 CACCAGACTCAGGAGCCCAGTGG - Intergenic
1201708119 Y:16959239-16959261 CACTAGACCAAGGAGCCCTCTGG - Intergenic