ID: 1088684321

View in Genome Browser
Species Human (GRCh38)
Location 11:112272259-112272281
Sequence CTAAACTGCCTGGCAATATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088684321_1088684325 14 Left 1088684321 11:112272259-112272281 CCTGATATTGCCAGGCAGTTTAG No data
Right 1088684325 11:112272296-112272318 GCTTAGAAGCCACAATGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088684321 Original CRISPR CTAAACTGCCTGGCAATATC AGG (reversed) Intergenic
No off target data available for this crispr