ID: 1088685873

View in Genome Browser
Species Human (GRCh38)
Location 11:112284293-112284315
Sequence CAGGTGGATCACCTTGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088685873_1088685882 0 Left 1088685873 11:112284293-112284315 CCGACCCCAAGGTGATCCACCTG No data
Right 1088685882 11:112284316-112284338 CCTTGGCCTCCCGAAGTGCTGGG 0: 1622
1: 89495
2: 214820
3: 238809
4: 160623
1088685873_1088685880 -1 Left 1088685873 11:112284293-112284315 CCGACCCCAAGGTGATCCACCTG No data
Right 1088685880 11:112284315-112284337 GCCTTGGCCTCCCGAAGTGCTGG 0: 1080
1: 56736
2: 170427
3: 220182
4: 183416
1088685873_1088685887 27 Left 1088685873 11:112284293-112284315 CCGACCCCAAGGTGATCCACCTG No data
Right 1088685887 11:112284343-112284365 CAGGCATGAGCCACCGTGCCTGG 0: 6929
1: 41657
2: 112181
3: 156808
4: 166907
1088685873_1088685884 8 Left 1088685873 11:112284293-112284315 CCGACCCCAAGGTGATCCACCTG No data
Right 1088685884 11:112284324-112284346 TCCCGAAGTGCTGGGATTACAGG 0: 4899
1: 294023
2: 265853
3: 205200
4: 295969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088685873 Original CRISPR CAGGTGGATCACCTTGGGGT CGG (reversed) Intergenic
No off target data available for this crispr