ID: 1088688375

View in Genome Browser
Species Human (GRCh38)
Location 11:112304252-112304274
Sequence TGTTACAGGCATATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088688364_1088688375 15 Left 1088688364 11:112304214-112304236 CCTTGAAGTGGGTCAAGCATGGT No data
Right 1088688375 11:112304252-112304274 TGTTACAGGCATATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088688375 Original CRISPR TGTTACAGGCATATGGGGCA GGG Intergenic
No off target data available for this crispr