ID: 1088692159

View in Genome Browser
Species Human (GRCh38)
Location 11:112337406-112337428
Sequence AAGAGGGAAAGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088692159_1088692168 22 Left 1088692159 11:112337406-112337428 CCTTCCTCCCTCCTTTCCCTCTT No data
Right 1088692168 11:112337451-112337473 TCTGTCTCCTCTTTTCAGAATGG No data
1088692159_1088692169 23 Left 1088692159 11:112337406-112337428 CCTTCCTCCCTCCTTTCCCTCTT No data
Right 1088692169 11:112337452-112337474 CTGTCTCCTCTTTTCAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088692159 Original CRISPR AAGAGGGAAAGGAGGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr