ID: 1088692252

View in Genome Browser
Species Human (GRCh38)
Location 11:112338047-112338069
Sequence CCACAGGAGCAGAGGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088692245_1088692252 6 Left 1088692245 11:112338018-112338040 CCACCTGTGAGTGTTTGGGCAAC No data
Right 1088692252 11:112338047-112338069 CCACAGGAGCAGAGGGCAAAAGG No data
1088692246_1088692252 3 Left 1088692246 11:112338021-112338043 CCTGTGAGTGTTTGGGCAACAGT No data
Right 1088692252 11:112338047-112338069 CCACAGGAGCAGAGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088692252 Original CRISPR CCACAGGAGCAGAGGGCAAA AGG Intergenic
No off target data available for this crispr