ID: 1088692782

View in Genome Browser
Species Human (GRCh38)
Location 11:112342085-112342107
Sequence GCTGCTAGTGCACACACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088692773_1088692782 25 Left 1088692773 11:112342037-112342059 CCATTATCAGGCTTCTTTCCCAG No data
Right 1088692782 11:112342085-112342107 GCTGCTAGTGCACACACTCCTGG No data
1088692777_1088692782 7 Left 1088692777 11:112342055-112342077 CCCAGGTCCATCCTCTGGAGGAT No data
Right 1088692782 11:112342085-112342107 GCTGCTAGTGCACACACTCCTGG No data
1088692780_1088692782 0 Left 1088692780 11:112342062-112342084 CCATCCTCTGGAGGATGGCTTAT No data
Right 1088692782 11:112342085-112342107 GCTGCTAGTGCACACACTCCTGG No data
1088692778_1088692782 6 Left 1088692778 11:112342056-112342078 CCAGGTCCATCCTCTGGAGGATG No data
Right 1088692782 11:112342085-112342107 GCTGCTAGTGCACACACTCCTGG No data
1088692781_1088692782 -4 Left 1088692781 11:112342066-112342088 CCTCTGGAGGATGGCTTATGCTG No data
Right 1088692782 11:112342085-112342107 GCTGCTAGTGCACACACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088692782 Original CRISPR GCTGCTAGTGCACACACTCC TGG Intergenic
No off target data available for this crispr