ID: 1088693108

View in Genome Browser
Species Human (GRCh38)
Location 11:112344590-112344612
Sequence TGATCCCCCTGTGGCAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088693101_1088693108 13 Left 1088693101 11:112344554-112344576 CCTCAGAGCTATACTGGAAGGGA No data
Right 1088693108 11:112344590-112344612 TGATCCCCCTGTGGCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088693108 Original CRISPR TGATCCCCCTGTGGCAGAGG AGG Intergenic
No off target data available for this crispr