ID: 1088696267

View in Genome Browser
Species Human (GRCh38)
Location 11:112368656-112368678
Sequence CAGAAGCAGCAGGAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088696267_1088696272 -5 Left 1088696267 11:112368656-112368678 CCAGCCTCCTCCTGCTGCTTCTG No data
Right 1088696272 11:112368674-112368696 TTCTGCCGCTGGAGCCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088696267 Original CRISPR CAGAAGCAGCAGGAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr