ID: 1088696348

View in Genome Browser
Species Human (GRCh38)
Location 11:112369508-112369530
Sequence CTAAGCCTCAGTTCCTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088696348_1088696356 20 Left 1088696348 11:112369508-112369530 CCAGATGAGGAACTGAGGCTTAG No data
Right 1088696356 11:112369551-112369573 TGGGAAACACAACTGGGAAGTGG No data
1088696348_1088696350 0 Left 1088696348 11:112369508-112369530 CCAGATGAGGAACTGAGGCTTAG No data
Right 1088696350 11:112369531-112369553 AGGTGTTATGAACTTAGCCCTGG No data
1088696348_1088696352 13 Left 1088696348 11:112369508-112369530 CCAGATGAGGAACTGAGGCTTAG No data
Right 1088696352 11:112369544-112369566 TTAGCCCTGGGAAACACAACTGG No data
1088696348_1088696351 1 Left 1088696348 11:112369508-112369530 CCAGATGAGGAACTGAGGCTTAG No data
Right 1088696351 11:112369532-112369554 GGTGTTATGAACTTAGCCCTGGG No data
1088696348_1088696353 14 Left 1088696348 11:112369508-112369530 CCAGATGAGGAACTGAGGCTTAG No data
Right 1088696353 11:112369545-112369567 TAGCCCTGGGAAACACAACTGGG No data
1088696348_1088696357 29 Left 1088696348 11:112369508-112369530 CCAGATGAGGAACTGAGGCTTAG No data
Right 1088696357 11:112369560-112369582 CAACTGGGAAGTGGCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088696348 Original CRISPR CTAAGCCTCAGTTCCTCATC TGG (reversed) Intergenic
No off target data available for this crispr