ID: 1088707320

View in Genome Browser
Species Human (GRCh38)
Location 11:112475575-112475597
Sequence ATCAGTGCTAGGAAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088707320_1088707329 18 Left 1088707320 11:112475575-112475597 CCCAGGGCCTTCCTAGCACTGAT No data
Right 1088707329 11:112475616-112475638 TCTAGGTATAGACTTCATCGGGG No data
1088707320_1088707328 17 Left 1088707320 11:112475575-112475597 CCCAGGGCCTTCCTAGCACTGAT No data
Right 1088707328 11:112475615-112475637 TTCTAGGTATAGACTTCATCGGG No data
1088707320_1088707327 16 Left 1088707320 11:112475575-112475597 CCCAGGGCCTTCCTAGCACTGAT No data
Right 1088707327 11:112475614-112475636 ATTCTAGGTATAGACTTCATCGG No data
1088707320_1088707325 1 Left 1088707320 11:112475575-112475597 CCCAGGGCCTTCCTAGCACTGAT No data
Right 1088707325 11:112475599-112475621 TTCAATGGCCTTGTAATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088707320 Original CRISPR ATCAGTGCTAGGAAGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr