ID: 1088709233

View in Genome Browser
Species Human (GRCh38)
Location 11:112491741-112491763
Sequence TTTCAAACCCCGATGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088709226_1088709233 13 Left 1088709226 11:112491705-112491727 CCCAGAGCCTCTGTTACTTGTGC No data
Right 1088709233 11:112491741-112491763 TTTCAAACCCCGATGGAGGCAGG No data
1088709227_1088709233 12 Left 1088709227 11:112491706-112491728 CCAGAGCCTCTGTTACTTGTGCT No data
Right 1088709233 11:112491741-112491763 TTTCAAACCCCGATGGAGGCAGG No data
1088709229_1088709233 6 Left 1088709229 11:112491712-112491734 CCTCTGTTACTTGTGCTCTGGAG No data
Right 1088709233 11:112491741-112491763 TTTCAAACCCCGATGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088709233 Original CRISPR TTTCAAACCCCGATGGAGGC AGG Intergenic
No off target data available for this crispr