ID: 1088710046

View in Genome Browser
Species Human (GRCh38)
Location 11:112499716-112499738
Sequence AACAGCAGAGGCACACACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088710046_1088710054 9 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710054 11:112499748-112499770 AAAAGGAGCCAGCACGGCTGGGG No data
1088710046_1088710057 21 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710057 11:112499760-112499782 CACGGCTGGGGATCAAGGCGAGG No data
1088710046_1088710049 -8 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG No data
1088710046_1088710052 7 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710052 11:112499746-112499768 ACAAAAGGAGCCAGCACGGCTGG No data
1088710046_1088710058 24 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710058 11:112499763-112499785 GGCTGGGGATCAAGGCGAGGCGG No data
1088710046_1088710051 3 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710051 11:112499742-112499764 GAGGACAAAAGGAGCCAGCACGG No data
1088710046_1088710055 16 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710055 11:112499755-112499777 GCCAGCACGGCTGGGGATCAAGG No data
1088710046_1088710053 8 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710053 11:112499747-112499769 CAAAAGGAGCCAGCACGGCTGGG No data
1088710046_1088710059 25 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710059 11:112499764-112499786 GCTGGGGATCAAGGCGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088710046 Original CRISPR AACAGCAGAGGCACACACAA TGG (reversed) Intergenic
No off target data available for this crispr