ID: 1088710049

View in Genome Browser
Species Human (GRCh38)
Location 11:112499731-112499753
Sequence CTGCTGTTCCAGAGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088710046_1088710049 -8 Left 1088710046 11:112499716-112499738 CCATTGTGTGTGCCTCTGCTGTT No data
Right 1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG No data
1088710045_1088710049 15 Left 1088710045 11:112499693-112499715 CCAGTGCAGGGATCTCAACATAG No data
Right 1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088710049 Original CRISPR CTGCTGTTCCAGAGGACAAA AGG Intergenic
No off target data available for this crispr