ID: 1088713468

View in Genome Browser
Species Human (GRCh38)
Location 11:112528419-112528441
Sequence CTATTTCAGATCCTTTTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088713468_1088713473 16 Left 1088713468 11:112528419-112528441 CCTATTAAAAGGATCTGAAATAG No data
Right 1088713473 11:112528458-112528480 GTGAACTCTCAATGGAACAATGG No data
1088713468_1088713472 8 Left 1088713468 11:112528419-112528441 CCTATTAAAAGGATCTGAAATAG No data
Right 1088713472 11:112528450-112528472 GGCTGAATGTGAACTCTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088713468 Original CRISPR CTATTTCAGATCCTTTTAAT AGG (reversed) Intergenic
No off target data available for this crispr