ID: 1088715493

View in Genome Browser
Species Human (GRCh38)
Location 11:112545574-112545596
Sequence CAGTCATGTTCAGGTTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088715493_1088715496 8 Left 1088715493 11:112545574-112545596 CCTGTACAACCTGAACATGACTG No data
Right 1088715496 11:112545605-112545627 TCATCTTATGGTAAAATCAGTGG No data
1088715493_1088715495 -4 Left 1088715493 11:112545574-112545596 CCTGTACAACCTGAACATGACTG No data
Right 1088715495 11:112545593-112545615 ACTGTAATACTCTCATCTTATGG No data
1088715493_1088715497 20 Left 1088715493 11:112545574-112545596 CCTGTACAACCTGAACATGACTG No data
Right 1088715497 11:112545617-112545639 AAAATCAGTGGCATCTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088715493 Original CRISPR CAGTCATGTTCAGGTTGTAC AGG (reversed) Intergenic
No off target data available for this crispr