ID: 1088715962

View in Genome Browser
Species Human (GRCh38)
Location 11:112549979-112550001
Sequence TCTATAGATTCTTCCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088715961_1088715962 4 Left 1088715961 11:112549952-112549974 CCAGTGAATCTGACTTTATTTAA No data
Right 1088715962 11:112549979-112550001 TCTATAGATTCTTCCTCCTCTGG No data
1088715960_1088715962 19 Left 1088715960 11:112549937-112549959 CCAATTCTGTTTGTTCCAGTGAA No data
Right 1088715962 11:112549979-112550001 TCTATAGATTCTTCCTCCTCTGG No data
1088715959_1088715962 20 Left 1088715959 11:112549936-112549958 CCCAATTCTGTTTGTTCCAGTGA No data
Right 1088715962 11:112549979-112550001 TCTATAGATTCTTCCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088715962 Original CRISPR TCTATAGATTCTTCCTCCTC TGG Intergenic
No off target data available for this crispr