ID: 1088715963

View in Genome Browser
Species Human (GRCh38)
Location 11:112549980-112550002
Sequence CTATAGATTCTTCCTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088715961_1088715963 5 Left 1088715961 11:112549952-112549974 CCAGTGAATCTGACTTTATTTAA No data
Right 1088715963 11:112549980-112550002 CTATAGATTCTTCCTCCTCTGGG No data
1088715960_1088715963 20 Left 1088715960 11:112549937-112549959 CCAATTCTGTTTGTTCCAGTGAA No data
Right 1088715963 11:112549980-112550002 CTATAGATTCTTCCTCCTCTGGG No data
1088715959_1088715963 21 Left 1088715959 11:112549936-112549958 CCCAATTCTGTTTGTTCCAGTGA No data
Right 1088715963 11:112549980-112550002 CTATAGATTCTTCCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088715963 Original CRISPR CTATAGATTCTTCCTCCTCT GGG Intergenic
No off target data available for this crispr