ID: 1088720672

View in Genome Browser
Species Human (GRCh38)
Location 11:112589409-112589431
Sequence CTGTCTGAGCAGAGGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088720665_1088720672 8 Left 1088720665 11:112589378-112589400 CCACTGAATAAAGTCACTACATC No data
Right 1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088720672 Original CRISPR CTGTCTGAGCAGAGGGGCCC TGG Intergenic
No off target data available for this crispr