ID: 1088726083

View in Genome Browser
Species Human (GRCh38)
Location 11:112636468-112636490
Sequence CTGCTTTTATGAAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088726077_1088726083 15 Left 1088726077 11:112636430-112636452 CCTCTGAGTAGATCACTATTAAG No data
Right 1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG No data
1088726076_1088726083 18 Left 1088726076 11:112636427-112636449 CCACCTCTGAGTAGATCACTATT No data
Right 1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088726083 Original CRISPR CTGCTTTTATGAAGGAAAAA AGG Intergenic
No off target data available for this crispr