ID: 1088728137

View in Genome Browser
Species Human (GRCh38)
Location 11:112657434-112657456
Sequence CTTGTGGGCCCCCCTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088728137_1088728148 10 Left 1088728137 11:112657434-112657456 CCACACCCAGGGGGGCCCACAAG No data
Right 1088728148 11:112657467-112657489 ACCCTCTGCAGGCCCTGGAGGGG No data
1088728137_1088728146 8 Left 1088728137 11:112657434-112657456 CCACACCCAGGGGGGCCCACAAG No data
Right 1088728146 11:112657465-112657487 GAACCCTCTGCAGGCCCTGGAGG No data
1088728137_1088728145 5 Left 1088728137 11:112657434-112657456 CCACACCCAGGGGGGCCCACAAG No data
Right 1088728145 11:112657462-112657484 GAAGAACCCTCTGCAGGCCCTGG No data
1088728137_1088728147 9 Left 1088728137 11:112657434-112657456 CCACACCCAGGGGGGCCCACAAG No data
Right 1088728147 11:112657466-112657488 AACCCTCTGCAGGCCCTGGAGGG No data
1088728137_1088728142 -1 Left 1088728137 11:112657434-112657456 CCACACCCAGGGGGGCCCACAAG No data
Right 1088728142 11:112657456-112657478 GACCCAGAAGAACCCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088728137 Original CRISPR CTTGTGGGCCCCCCTGGGTG TGG (reversed) Intergenic
No off target data available for this crispr